Incidental Mutation 'R4024:Usf3'
ID475291
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R4024 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44216165 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 336 (V336E)
Ref Sequence ENSEMBL: ENSMUSP00000128627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088356] [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably benign
Transcript: ENSMUST00000088356
SMART Domains Protein: ENSMUSP00000085694
Gene: ENSMUSG00000068284

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119746
AA Change: V336E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: V336E

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141015
Predicted Effect possibly damaging
Transcript: ENSMUST00000169582
AA Change: V336E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: V336E

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Hnmt T C 2: 24,003,765 D239G probably benign Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 unclassified probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Predicted Primers
Posted On2017-04-14