Incidental Mutation 'R0506:Pkhd1'
ID47539
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Namepolycystic kidney and hepatic disease 1
SynonymsFPC, tigmin
MMRRC Submission 038701-MU
Accession Numbers

Genbank: NM_153179; MGI: 2155808

Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R0506 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20057779-20618064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20559469 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 637 (M637K)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
Predicted Effect probably benign
Transcript: ENSMUST00000088448
AA Change: M637K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: M637K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A possibly damaging Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20566874 critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20524070 missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20081184 critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20571390 missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20117747 missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20523258 missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20209176 missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20534530 splice site probably benign
IGL01313:Pkhd1 APN 1 20201024 missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20522977 missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20549715 missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20199459 missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20559419 critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20116979 missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20534633 nonsense probably null
IGL01790:Pkhd1 APN 1 20558671 missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20358910 missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20103235 missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20220083 missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20198137 missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20523567 missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20522747 missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20201227 missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20377399 missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20117195 missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20275615 missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20584101 missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20209260 missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20070376 critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20200783 missense probably benign
IGL02389:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20199486 missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20562418 missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20414421 missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20522759 missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20364201 missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20392165 missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20073507 missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20310710 missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20520256 missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20550902 missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20558752 missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20220029 splice site probably benign
IGL02752:Pkhd1 APN 1 20553591 missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20361011 missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20608416 nonsense probably null
IGL02960:Pkhd1 APN 1 20377446 missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20522963 missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20522699 missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20565633 missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20198171 missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20201019 missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20081300 splice site probably benign
IGL03375:Pkhd1 APN 1 20117023 missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20200670 missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20522894 missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20537365 missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20611414 intron probably benign
P0035:Pkhd1 UTSW 1 20117347 missense probably benign 0.00
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0115:Pkhd1 UTSW 1 20350490 missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20358917 missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20540400 missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20549822 splice site probably null
R0323:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20381547 missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20117788 missense probably damaging 1.00
R0512:Pkhd1 UTSW 1 20310514 splice site probably benign
R0550:Pkhd1 UTSW 1 20347223 missense probably null 1.00
R0584:Pkhd1 UTSW 1 20239436 nonsense probably null
R0586:Pkhd1 UTSW 1 20524111 missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20200890 missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20117173 missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20117474 missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20524230 missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20198107 missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20117484 missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20350521 missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20199381 missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20201259 missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20117726 missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20522829 missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20567456 missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20571405 missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20555223 splice site probably benign
R1411:Pkhd1 UTSW 1 20373896 missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20534558 missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20522983 missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20117780 missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20117401 missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20347440 missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20117825 missense probably benign
R1617:Pkhd1 UTSW 1 20198050 missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20522897 missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20584129 missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20550840 splice site probably benign
R1753:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20565711 missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20585152 splice site probably benign
R1822:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20117069 missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20615267 critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20566756 critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20081300 splice site probably benign
R1969:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20117060 missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20199459 missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20200669 missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20612812 missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20201335 missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20553574 nonsense probably null
R2142:Pkhd1 UTSW 1 20523895 missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20414220 critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20553517 missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20537360 missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20565639 missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20534535 critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20200849 missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20200855 missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20201165 missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20209182 missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20222961 missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20104599 missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20555129 missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20585655 missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20058300 makesense probably null
R3838:Pkhd1 UTSW 1 20534629 missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20558723 missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20200927 missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20312138 nonsense probably null
R3926:Pkhd1 UTSW 1 20550873 missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20209277 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20563686 missense probably benign 0.06
R4255:Pkhd1 UTSW 1 20593934 missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20058384 missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20058617 missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20414292 missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20239411 missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20523314 missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20211858 missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20534719 missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20613409 missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20200868 missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20503056 missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20364167 missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20081228 missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20524130 missense probably benign
R4750:Pkhd1 UTSW 1 20524112 missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20199415 missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20537401 missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20070488 missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20209226 missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20288205 missense probably null 0.01
R5062:Pkhd1 UTSW 1 20585711 missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20200757 missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20585191 missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20209224 missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20547341 missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20275641 missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20534545 missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20350411 critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20565870 missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20450304 missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20392097 missense probably benign
R5346:Pkhd1 UTSW 1 20523434 missense probably damaging 0.96
R5431:Pkhd1 UTSW 1 20117836 missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20239385 missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20201156 missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20377404 missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20081252 missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20523142 missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20073526 missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20558626 missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20588531 missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20547461 missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20523651 nonsense probably null
R5760:Pkhd1 UTSW 1 20073554 missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20209185 missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20058600 missense probably benign
R5810:Pkhd1 UTSW 1 20200673 missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20199405 missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20058678 missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20201083 missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20381461 missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20374736 nonsense probably null
R5852:Pkhd1 UTSW 1 20377408 missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20520210 missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20523770 missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20211951 missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20551020 missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20585703 missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20200823 missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20612705 missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20058339 missense probably benign
R6886:Pkhd1 UTSW 1 20347280 missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20523515 missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20534701 missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20562451 missense probably benign 0.19
X0012:Pkhd1 UTSW 1 20373926 missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20520226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACGGAGTACTGACTCACTGAAG -3'
(R):5'- GGGAATATAGCACCCAGACACTTGC -3'

Sequencing Primer
(F):5'- CATGTCAGTGAAGTGCAGATTCTC -3'
(R):5'- ACCCAGACACTTGCATAGC -3'
Posted On2013-06-12