Incidental Mutation 'R5310:Ap2a1'
ID475433
Institutional Source Beutler Lab
Gene Symbol Ap2a1
Ensembl Gene ENSMUSG00000060279
Gene Nameadaptor-related protein complex 2, alpha 1 subunit
SynonymsAdtaa
MMRRC Submission 042893-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R5310 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44900373-44929496 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 44906065 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930]
Predicted Effect probably null
Transcript: ENSMUST00000085399
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107857
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166972
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167930
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207426
Predicted Effect probably benign
Transcript: ENSMUST00000207814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208291
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209067
Meta Mutation Damage Score 0.654 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 adaptin subunit of the adaptor protein 2 (AP-2) complex found in clathrin coated vesicles. The AP-2 complex is a heterotetramer consisting of two large adaptins (alpha or beta), a medium adaptin (mu), and a small adaptin (sigma). The complex is part of the protein coat on the cytoplasmic face of coated vesicles which links clathrin to receptors in vesicles. Alternative splicing of this gene results in two transcript variants encoding two different isoforms. A third transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A C 1: 26,685,088 V337G probably benign Het
Abca15 A T 7: 120,332,616 I31L possibly damaging Het
Abca17 T C 17: 24,281,230 K1329R probably benign Het
Acap2 A G 16: 31,133,609 Y197H probably benign Het
Adgrv1 A G 13: 81,476,690 V3720A possibly damaging Het
Alms1 T A 6: 85,615,368 S870T possibly damaging Het
Anapc4 A G 5: 52,859,159 E493G probably benign Het
Arhgef38 A G 3: 133,116,466 L179P probably damaging Het
Bicral T C 17: 46,813,983 D630G possibly damaging Het
Ccdc97 A T 7: 25,715,776 L154Q probably damaging Het
Cd40 T C 2: 165,063,563 probably null Het
Celsr1 T A 15: 85,926,222 N2155I possibly damaging Het
Cemip A T 7: 83,992,033 L261H probably damaging Het
Cep57 G A 9: 13,818,868 H98Y probably damaging Het
Chrna7 A T 7: 63,106,057 L247Q probably damaging Het
Cyp2c40 T A 19: 39,778,030 M374L probably damaging Het
Cyp4f13 T C 17: 32,925,821 D372G probably damaging Het
Dazl C A 17: 50,281,283 S288I probably damaging Het
Dnah5 T C 15: 28,311,328 F1818L probably damaging Het
Echdc1 T C 10: 29,334,208 V143A possibly damaging Het
Eif4enif1 T A 11: 3,242,687 H838Q probably damaging Het
Erich3 A T 3: 154,763,580 D1223V probably damaging Het
Fbxl2 A G 9: 113,986,508 I229T possibly damaging Het
Gfm2 G A 13: 97,163,151 A406T probably damaging Het
Ggnbp2 A G 11: 84,869,968 M1T probably null Het
Glb1l2 C T 9: 26,796,866 probably benign Het
Gnl2 A G 4: 125,052,840 K618R probably benign Het
Greb1 A T 12: 16,716,759 I346K probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gtse1 A G 15: 85,873,792 Q533R probably benign Het
Hemgn A G 4: 46,403,927 S23P possibly damaging Het
Htr6 G T 4: 139,061,666 H359Q probably damaging Het
Ifit1 T C 19: 34,648,804 F447L probably benign Het
Kansl1 T C 11: 104,424,858 Y118C possibly damaging Het
Khk G A 5: 30,927,029 V118M probably benign Het
Klra17 T A 6: 129,868,708 K181M probably damaging Het
Lbh T C 17: 72,921,292 probably null Het
Lmo2 T C 2: 103,976,100 I108T probably damaging Het
Mgat5 T A 1: 127,387,514 probably null Het
Mink1 T C 11: 70,607,343 V525A probably benign Het
Myo10 C A 15: 25,778,078 probably null Het
Nlrp2 T C 7: 5,325,008 N682S probably benign Het
Nr2e3 G A 9: 59,949,334 probably benign Het
Olfr1415 T C 1: 92,491,036 T240A probably damaging Het
Olfr467 T C 7: 107,814,964 C129R probably damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pfas G A 11: 68,988,021 S1319F probably damaging Het
Phf3 T C 1: 30,803,806 K2024R probably damaging Het
Pld4 G A 12: 112,768,612 C501Y probably damaging Het
Psg16 C T 7: 17,090,635 R115W probably damaging Het
Rab3gap1 G A 1: 127,942,373 probably null Het
Rimkla C A 4: 119,477,852 K111N probably damaging Het
Rrm2b T C 15: 37,927,327 E113G probably damaging Het
Rspry1 C T 8: 94,623,185 T67I probably benign Het
Skint6 C A 4: 113,184,768 E292* probably null Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc13a1 A G 6: 24,134,374 M170T probably benign Het
Slc15a5 T C 6: 138,073,036 N127S probably benign Het
Slc39a10 G A 1: 46,836,125 H6Y probably damaging Het
Sugct A T 13: 17,252,560 C338* probably null Het
Tbk1 A T 10: 121,556,051 M486K probably benign Het
Terf1 A T 1: 15,805,685 E3V probably damaging Het
Thoc5 T A 11: 4,910,648 Y246N probably damaging Het
Tmem167b G A 3: 108,562,099 probably benign Het
Tmem57 T C 4: 134,837,019 probably benign Het
Tmtc1 T A 6: 148,355,412 probably benign Het
Zfp322a A T 13: 23,357,362 M70K possibly damaging Het
Zfp979 A T 4: 147,613,918 H111Q possibly damaging Het
Other mutations in Ap2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ap2a1 APN 7 44905768 missense probably damaging 1.00
IGL01315:Ap2a1 APN 7 44916289 missense possibly damaging 0.47
IGL01324:Ap2a1 APN 7 44905696 missense probably damaging 1.00
IGL02545:Ap2a1 APN 7 44906426 missense probably damaging 1.00
IGL03067:Ap2a1 APN 7 44903511 missense probably benign
IGL03172:Ap2a1 APN 7 44904055 missense probably benign 0.00
disaffected UTSW 7 44916164 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0233:Ap2a1 UTSW 7 44915973 missense probably damaging 1.00
R0546:Ap2a1 UTSW 7 44904708 missense probably damaging 0.97
R1103:Ap2a1 UTSW 7 44904169 unclassified probably benign
R1566:Ap2a1 UTSW 7 44903480 missense probably benign 0.02
R1682:Ap2a1 UTSW 7 44915938 missense probably benign 0.14
R1745:Ap2a1 UTSW 7 44906945 missense probably damaging 1.00
R1777:Ap2a1 UTSW 7 44904152 missense probably damaging 1.00
R4627:Ap2a1 UTSW 7 44904419 missense probably damaging 1.00
R4669:Ap2a1 UTSW 7 44902919 unclassified probably benign
R4776:Ap2a1 UTSW 7 44901546 unclassified probably benign
R4909:Ap2a1 UTSW 7 44906381 missense probably damaging 1.00
R5040:Ap2a1 UTSW 7 44905804 missense possibly damaging 0.78
R5278:Ap2a1 UTSW 7 44902779 missense probably benign 0.00
R5517:Ap2a1 UTSW 7 44906981 missense possibly damaging 0.93
R5635:Ap2a1 UTSW 7 44923901 intron probably benign
R6002:Ap2a1 UTSW 7 44904395 unclassified probably null
R6083:Ap2a1 UTSW 7 44907751 missense probably damaging 1.00
R6185:Ap2a1 UTSW 7 44916170 missense probably damaging 1.00
R6430:Ap2a1 UTSW 7 44903829 missense probably benign
R6491:Ap2a1 UTSW 7 44916164 missense probably damaging 1.00
R7058:Ap2a1 UTSW 7 44900791 missense probably damaging 1.00
R7180:Ap2a1 UTSW 7 44923804 intron probably null
Predicted Primers PCR Primer
(F):5'- ACTGCATACTTCTCAGCCAGG -3'
(R):5'- AGATCCCAGCTTACTCCTGC -3'

Sequencing Primer
(F):5'- CGATGTGTGAGGACAATCATGCC -3'
(R):5'- GCTCTCCTTTCCTCAGACGGAG -3'
Posted On2017-04-19