Incidental Mutation 'R5287:Cd46'
ID475439
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene NameCD46 antigen, complement regulatory protein
SynonymsCD46, Mcp
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195036826-195092249 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 195062411 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 340 (V340I)
Ref Sequence ENSEMBL: ENSMUSP00000123931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
Predicted Effect probably benign
Transcript: ENSMUST00000159563
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161772
Predicted Effect possibly damaging
Transcript: ENSMUST00000162650
AA Change: V340I

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: V340I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162951
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Celf1 T C 2: 91,009,207 S326P possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 195085424 missense probably benign 0.01
IGL03029:Cd46 APN 1 195086143 missense probably benign 0.43
R0269:Cd46 UTSW 1 195064688 missense probably benign 0.00
R0375:Cd46 UTSW 1 195086164 missense probably benign 0.00
R0627:Cd46 UTSW 1 195092186 missense probably benign 0.03
R0784:Cd46 UTSW 1 195092194 missense possibly damaging 0.96
R0892:Cd46 UTSW 1 195082612 missense possibly damaging 0.78
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0973:Cd46 UTSW 1 195041992 makesense probably null
R0974:Cd46 UTSW 1 195041992 makesense probably null
R1224:Cd46 UTSW 1 195062398 missense possibly damaging 0.66
R1716:Cd46 UTSW 1 195077809 missense probably benign 0.21
R1863:Cd46 UTSW 1 195083623 missense probably damaging 1.00
R2000:Cd46 UTSW 1 195077704 missense probably benign 0.00
R2152:Cd46 UTSW 1 195062413 missense probably benign 0.42
R2153:Cd46 UTSW 1 195062413 missense probably benign 0.42
R4452:Cd46 UTSW 1 195085360 missense possibly damaging 0.84
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4860:Cd46 UTSW 1 195062396 missense possibly damaging 0.94
R4934:Cd46 UTSW 1 195082799 intron probably benign
R5156:Cd46 UTSW 1 195085385 missense possibly damaging 0.90
R5303:Cd46 UTSW 1 195062399 missense probably benign
R5403:Cd46 UTSW 1 195062411 missense possibly damaging 0.65
R5487:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R5505:Cd46 UTSW 1 195085380 missense possibly damaging 0.88
R5538:Cd46 UTSW 1 195068170 critical splice acceptor site probably null
R6721:Cd46 UTSW 1 195083631 missense probably damaging 1.00
R6731:Cd46 UTSW 1 195083467 intron probably null
R7226:Cd46 UTSW 1 195042006 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GATCCTTATGCTGCAATGATGTC -3'
(R):5'- GAGAAACCCTGTAGTTCCAGC -3'

Sequencing Primer
(F):5'- AGTTGACCACACTTTAGCAAAG -3'
(R):5'- CTGTAGTTCCAGCTACACAGAG -3'
Posted On2017-04-20