Incidental Mutation 'R5287:Celf1'
ID475440
Institutional Source Beutler Lab
Gene Symbol Celf1
Ensembl Gene ENSMUSG00000005506
Gene NameCUGBP, Elav-like family member 1
SynonymsCUG-BP, D2Wsu101e, 1600010O03Rik, Brunol2, Cugbp1, CUG-BP1
MMRRC Submission 042871-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R5287 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90940382-91019497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91009207 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 326 (S326P)
Ref Sequence ENSEMBL: ENSMUSP00000107082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005643] [ENSMUST00000068726] [ENSMUST00000068747] [ENSMUST00000111448] [ENSMUST00000111449] [ENSMUST00000111451] [ENSMUST00000111452] [ENSMUST00000111455] [ENSMUST00000177642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005643
AA Change: S326P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005643
Gene: ENSMUSG00000005506
AA Change: S326P

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068726
AA Change: S300P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064323
Gene: ENSMUSG00000005506
AA Change: S300P

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 283 315 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
RRM 403 476 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000068747
AA Change: S299P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070438
Gene: ENSMUSG00000005506
AA Change: S299P

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111448
AA Change: S296P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107075
Gene: ENSMUSG00000005506
AA Change: S296P

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 279 311 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 328 353 N/A INTRINSIC
RRM 399 472 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111449
AA Change: S299P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107076
Gene: ENSMUSG00000005506
AA Change: S299P

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111451
AA Change: S299P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107078
Gene: ENSMUSG00000005506
AA Change: S299P

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111452
AA Change: S326P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107079
Gene: ENSMUSG00000005506
AA Change: S326P

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111455
AA Change: S326P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107082
Gene: ENSMUSG00000005506
AA Change: S326P

DomainStartEndE-ValueType
RRM 44 122 5.93e-17 SMART
RRM 136 211 2.52e-20 SMART
low complexity region 226 234 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
low complexity region 283 303 N/A INTRINSIC
low complexity region 311 338 N/A INTRINSIC
low complexity region 342 355 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
RRM 429 502 1.71e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127385
Predicted Effect possibly damaging
Transcript: ENSMUST00000177642
AA Change: S299P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136109
Gene: ENSMUSG00000005506
AA Change: S299P

DomainStartEndE-ValueType
RRM 17 95 5.93e-17 SMART
RRM 109 184 2.52e-20 SMART
low complexity region 199 207 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 311 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 331 356 N/A INTRINSIC
RRM 402 475 1.71e-22 SMART
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in significant postnatal lethality, growth retardation, and impaired fertility in both sexes. Male infertility is caused by a blockage of spermiogenesis at stage 7 and increased germ cell apoptosis but is not fully penetrant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G T 17: 56,876,221 probably benign Het
Accs T C 2: 93,835,953 D463G probably damaging Het
Adcy8 C T 15: 64,716,152 V929I probably benign Het
Anp32a A T 9: 62,341,993 I16F possibly damaging Het
Arpin T C 7: 79,928,249 E144G probably damaging Het
Asb18 T C 1: 90,014,388 T64A probably benign Het
Asxl2 A G 12: 3,496,893 N559S probably benign Het
Brd7 G T 8: 88,357,541 Q148K probably damaging Het
Brinp1 A G 4: 68,792,964 W336R probably benign Het
Btnl9 A G 11: 49,169,607 V438A probably benign Het
Cat T C 2: 103,474,360 T107A probably damaging Het
Catsperg2 T C 7: 29,697,838 Y1080C possibly damaging Het
Ccdc138 T A 10: 58,575,705 F632I possibly damaging Het
Cd46 C T 1: 195,062,411 V340I possibly damaging Het
Ces1e T G 8: 93,208,612 D404A probably benign Het
Chd3 A T 11: 69,349,069 probably null Het
Clhc1 A G 11: 29,578,244 probably benign Het
Cops8 C T 1: 90,606,620 probably benign Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Csmd2 C T 4: 128,486,884 R2078C probably benign Het
Dnm1l A C 16: 16,333,868 V240G probably damaging Het
Fam109a A G 5: 121,852,731 E52G possibly damaging Het
Fam196b A T 11: 34,403,058 T367S probably benign Het
Fam208b G A 13: 3,575,744 S1402L probably benign Het
Fezf1 C T 6: 23,248,011 V22M probably benign Het
Gm6818 T G 7: 38,400,487 noncoding transcript Het
Hand2 C T 8: 57,322,045 L47F probably damaging Het
Itga7 C A 10: 128,943,158 R351S probably benign Het
Mmp8 G T 9: 7,567,506 A456S probably benign Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Olfr1416 A T 1: 92,480,297 V108E possibly damaging Het
Opn4 T C 14: 34,592,937 T460A probably benign Het
Otog T C 7: 46,269,329 F943S probably damaging Het
Pcnx A T 12: 81,982,051 Y1668F probably damaging Het
Phf24 A T 4: 42,933,831 probably null Het
Phkg2 GCTGCCGGACGAGTGGCCT GCT 7: 127,582,757 probably null Het
Ppargc1a G A 5: 51,462,825 probably benign Het
Ptprd G A 4: 75,954,168 R1355* probably null Het
Ptprn2 A T 12: 117,211,862 M721L probably damaging Het
Sec23ip A G 7: 128,766,136 E624G probably benign Het
Sfmbt1 G A 14: 30,816,820 V799M probably damaging Het
Snrnp200 T C 2: 127,231,687 V1335A probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Spdye4c T C 2: 128,592,640 S46P possibly damaging Het
Syde1 T C 10: 78,590,037 R99G probably benign Het
T2 A T 17: 8,418,003 M57L probably benign Het
Tfap2e T C 4: 126,734,646 I172M probably benign Het
Tk1 A T 11: 117,816,541 V140E probably damaging Het
Tln2 G A 9: 67,242,359 T1192M probably damaging Het
Tmed8 C A 12: 87,174,183 A210S probably damaging Het
Tnip2 A G 5: 34,513,764 L45P probably damaging Het
Ttc3 T C 16: 94,459,844 V1396A probably benign Het
Ttn G T 2: 76,732,092 S28803Y probably damaging Het
Wdr90 A T 17: 25,861,467 probably benign Het
Zfp7 G A 15: 76,891,222 R488Q probably damaging Het
Other mutations in Celf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Celf1 APN 2 91009207 missense possibly damaging 0.83
IGL02126:Celf1 APN 2 91001063 missense probably damaging 1.00
IGL02183:Celf1 APN 2 91001486 missense probably damaging 1.00
IGL02350:Celf1 APN 2 90998588 missense probably damaging 0.97
IGL02357:Celf1 APN 2 90998588 missense probably damaging 0.97
IGL02402:Celf1 APN 2 90998723 missense probably damaging 1.00
IGL02522:Celf1 APN 2 91009301 missense possibly damaging 0.46
R0033:Celf1 UTSW 2 91001453 splice site probably benign
R0033:Celf1 UTSW 2 91001453 splice site probably benign
R0147:Celf1 UTSW 2 91004690 splice site probably benign
R2008:Celf1 UTSW 2 91010408 missense probably damaging 0.97
R2132:Celf1 UTSW 2 91010446 missense probably damaging 1.00
R3769:Celf1 UTSW 2 90998648 missense probably damaging 1.00
R3845:Celf1 UTSW 2 91009238 missense possibly damaging 0.46
R3857:Celf1 UTSW 2 91012741 missense probably damaging 0.98
R3858:Celf1 UTSW 2 91012741 missense probably damaging 0.98
R5174:Celf1 UTSW 2 91001008 missense probably damaging 1.00
R6395:Celf1 UTSW 2 91003858 missense probably benign 0.01
R6993:Celf1 UTSW 2 91010476 missense probably damaging 1.00
R7063:Celf1 UTSW 2 91012844 critical splice donor site probably null
R7242:Celf1 UTSW 2 91003257 nonsense probably null
R7419:Celf1 UTSW 2 91003243 missense probably benign
R7502:Celf1 UTSW 2 91004755 nonsense probably null
X0062:Celf1 UTSW 2 90998594 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTTTGTTGTAACCATCATTTGTGCC -3'
(R):5'- GTTTCACACTTCATTCTGGGG -3'

Sequencing Primer
(F):5'- CCATCATTTGTGCCTGACTTAGAAGG -3'
(R):5'- TTAAAGGCGTGTGTCACCAC -3'
Posted On2017-04-20