Incidental Mutation 'R5325:Odf2'
ID475445
Institutional Source Beutler Lab
Gene Symbol Odf2
Ensembl Gene ENSMUSG00000026790
Gene Nameouter dense fiber of sperm tails 2
SynonymsMMTEST29, cenexin
MMRRC Submission 042908-MU
Accession Numbers

Genbank: NM_001113213; MGI: 1098824 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5325 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29889221-29931746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29912571 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 282 (D282E)
Ref Sequence ENSEMBL: ENSMUSP00000109394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028128] [ENSMUST00000046571] [ENSMUST00000113755] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113762] [ENSMUST00000113763] [ENSMUST00000113764] [ENSMUST00000113765] [ENSMUST00000113767] [ENSMUST00000184845]
Predicted Effect probably benign
Transcript: ENSMUST00000028128
AA Change: D263E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028128
Gene: ENSMUSG00000026790
AA Change: D263E

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000046571
AA Change: D277E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790
AA Change: D277E

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113755
AA Change: D277E

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109384
Gene: ENSMUSG00000026790
AA Change: D277E

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 2.12e-5 PROSPERO
internal_repeat_1 461 495 2.12e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113756
AA Change: D277E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790
AA Change: D277E

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113757
AA Change: D258E

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790
AA Change: D258E

DomainStartEndE-ValueType
internal_repeat_2 101 119 9.13e-6 PROSPERO
coiled coil region 120 192 N/A INTRINSIC
internal_repeat_2 199 217 9.13e-6 PROSPERO
internal_repeat_1 243 279 3.83e-7 PROSPERO
internal_repeat_1 442 476 3.83e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113759
AA Change: D278E

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790
AA Change: D278E

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113762
AA Change: D282E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109391
Gene: ENSMUSG00000026790
AA Change: D282E

DomainStartEndE-ValueType
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_1 267 303 1.9e-5 PROSPERO
internal_repeat_1 466 500 1.9e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113763
AA Change: D263E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109392
Gene: ENSMUSG00000026790
AA Change: D263E

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113764
AA Change: D263E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109393
Gene: ENSMUSG00000026790
AA Change: D263E

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113765
AA Change: D282E

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790
AA Change: D282E

DomainStartEndE-ValueType
internal_repeat_2 125 143 1.66e-5 PROSPERO
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_2 223 241 1.66e-5 PROSPERO
internal_repeat_1 267 303 7.56e-7 PROSPERO
internal_repeat_1 466 500 7.56e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113767
AA Change: D326E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109396
Gene: ENSMUSG00000026790
AA Change: D326E

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
coiled coil region 188 260 N/A INTRINSIC
internal_repeat_1 311 347 3e-5 PROSPERO
internal_repeat_1 510 544 3e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152932
Predicted Effect probably benign
Transcript: ENSMUST00000184845
AA Change: D277E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790
AA Change: D277E

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 3.95e-5 PROSPERO
internal_repeat_1 461 495 3.95e-5 PROSPERO
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality before implantation and transmission ratio distortion while all heterozygous males display normal development and fertility. Males heterozygous for other alleles are either infertile orshow reduced fertility. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 T A 11: 106,005,253 M675K probably benign Het
Ccdc186 A T 19: 56,813,181 I168N probably damaging Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep83 A G 10: 94,737,906 E219G probably damaging Het
Ctsj T C 13: 61,004,025 T73A possibly damaging Het
Ddr2 T A 1: 170,001,837 T283S probably benign Het
Ehbp1 T A 11: 22,095,370 D768V possibly damaging Het
Evpl T C 11: 116,221,365 D1833G probably damaging Het
Exoc1 A G 5: 76,537,702 N87S probably benign Het
Fam98b A C 2: 117,270,651 I315L possibly damaging Het
Fancg A G 4: 43,006,564 V330A probably damaging Het
Fbxo30 G A 10: 11,291,102 V523I possibly damaging Het
Fbxw27 A G 9: 109,770,093 C419R probably damaging Het
Flt3 C A 5: 147,375,649 V161L probably benign Het
Fndc7 G A 3: 108,883,449 T87I probably damaging Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6457 A T 18: 14,570,441 noncoding transcript Het
Gm7075 A G 10: 63,421,679 S21P probably benign Het
Gpr63 T C 4: 25,007,294 V6A probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
H2-M10.2 C A 17: 36,285,579 V125L probably benign Het
Hrh4 C T 18: 13,021,997 Q198* probably null Het
Lrch4 A G 5: 137,637,906 E373G probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Noa1 A C 5: 77,304,195 D547E probably damaging Het
Nr2e1 G A 10: 42,572,784 R153W probably damaging Het
Nudt9 A C 5: 104,050,621 M1L possibly damaging Het
Olfr522 T A 7: 140,162,113 Y279F probably damaging Het
Olfr539 C A 7: 140,667,792 H168Q probably benign Het
Olfr908 A T 9: 38,516,158 N42I probably damaging Het
Osbpl5 C G 7: 143,691,928 A816P probably damaging Het
Pan2 T C 10: 128,317,634 I924T possibly damaging Het
Ppat A G 5: 76,928,422 probably benign Het
Rad50 T G 11: 53,692,863 I364L probably benign Het
Robo2 A G 16: 73,973,785 I484T possibly damaging Het
Ryr2 A T 13: 11,690,363 M2839K probably damaging Het
Sin3b A G 8: 72,750,526 D807G probably damaging Het
Sirpb1a G A 3: 15,411,443 T98I possibly damaging Het
Smim17 G A 7: 6,429,322 V88M probably damaging Het
Spib T C 7: 44,528,081 T229A probably damaging Het
St14 A T 9: 31,096,978 probably null Het
Syne4 A T 7: 30,318,976 Y381F probably damaging Het
Sytl1 T C 4: 133,261,071 probably benign Het
Tnpo3 A C 6: 29,602,013 probably benign Het
Trim12a T A 7: 104,304,206 I233F probably damaging Het
Tspan1 T A 4: 116,164,339 N82Y probably damaging Het
Vmn1r60 T A 7: 5,544,202 M300L probably benign Het
Wdr17 G A 8: 54,659,681 A788V possibly damaging Het
Wwtr1 A T 3: 57,575,237 V63E probably benign Het
Ylpm1 A G 12: 85,013,961 probably benign Het
Zfp956 T C 6: 47,951,078 probably benign Het
Other mutations in Odf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Odf2 APN 2 29893059 missense probably damaging 1.00
IGL01511:Odf2 APN 2 29914309 splice site probably benign
IGL01760:Odf2 APN 2 29914460 missense probably damaging 1.00
IGL02487:Odf2 APN 2 29920839 missense possibly damaging 0.80
IGL03047:Odf2 APN 2 29920895 splice site probably benign
IGL03057:Odf2 APN 2 29923645 intron probably benign
IGL03064:Odf2 APN 2 29901079 missense probably benign 0.28
3-1:Odf2 UTSW 2 29904075 nonsense probably null
IGL02837:Odf2 UTSW 2 29926713 missense probably damaging 0.99
R4025:Odf2 UTSW 2 29926815 missense probably damaging 1.00
R4227:Odf2 UTSW 2 29901284 intron probably benign
R4357:Odf2 UTSW 2 29892244 missense probably benign 0.00
R4417:Odf2 UTSW 2 29915321 splice site probably benign
R4512:Odf2 UTSW 2 29926097 unclassified probably null
R4705:Odf2 UTSW 2 29904034 missense probably damaging 1.00
R4815:Odf2 UTSW 2 29902240 missense possibly damaging 0.87
R5614:Odf2 UTSW 2 29920867 missense probably damaging 0.99
R6998:Odf2 UTSW 2 29912617 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGGAGGGCTGACTGTCAAAC -3'
(R):5'- GTAAGCAGCACAGCGCATG -3'

Sequencing Primer
(F):5'- GGCAACTCACAAGTCTTTGG -3'
(R):5'- CAGCGCATGTCAACCCATTTTATAG -3'
Posted On2017-04-24