Incidental Mutation 'R5159:Mup8'
ID475474
Institutional Source Beutler Lab
Gene Symbol Mup8
Ensembl Gene ENSMUSG00000078687
Gene Namemajor urinary protein 8
SynonymsGm12809
MMRRC Submission 042741-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5159 (G1)
Quality Score104
Status Not validated
Chromosome4
Chromosomal Location60218621-60222599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60221062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 101 (T101M)
Ref Sequence ENSEMBL: ENSMUSP00000128910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095058] [ENSMUST00000163931]
Predicted Effect probably benign
Transcript: ENSMUST00000095058
AA Change: T101M

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092668
Gene: ENSMUSG00000078687
AA Change: T101M

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 34 173 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163931
AA Change: T101M

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128910
Gene: ENSMUSG00000078687
AA Change: T101M

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 34 173 3.1e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,153,308 M1340K probably benign Het
9930111J21Rik1 T C 11: 48,948,525 T412A probably benign Het
Aldh5a1 T A 13: 24,913,793 M420L possibly damaging Het
Armc2 A G 10: 42,008,715 S77P probably damaging Het
Avil A G 10: 127,020,448 probably null Het
Bmp5 T A 9: 75,893,753 F388L probably damaging Het
Brca2 T G 5: 150,542,108 V1779G possibly damaging Het
Cblb T A 16: 52,112,120 S147T probably damaging Het
Cblc T C 7: 19,785,308 E409G probably benign Het
Cdc34b C T 11: 94,742,060 R29W probably damaging Het
Clic6 T A 16: 92,528,066 Y371N probably benign Het
Col5a2 A G 1: 45,386,831 probably null Het
Coro1a A T 7: 126,703,049 V42D probably damaging Het
Cpa3 C T 3: 20,227,223 C173Y probably damaging Het
Crb1 A C 1: 139,243,018 V817G probably damaging Het
Cyp2c39 A G 19: 39,560,934 T299A possibly damaging Het
Dock5 G A 14: 67,792,289 R1019C probably benign Het
Exoc8 T C 8: 124,896,213 T472A probably benign Het
Fancc A G 13: 63,321,865 probably null Het
Inpp5d T C 1: 87,676,342 L244P probably damaging Het
Ireb2 A G 9: 54,892,547 N424S probably benign Het
Krt35 T C 11: 100,094,049 D261G probably damaging Het
Lipc T A 9: 70,812,910 I272L probably benign Het
Lpcat3 A G 6: 124,699,394 probably benign Het
Lzts1 T C 8: 69,138,584 D304G probably benign Het
Mdn1 A G 4: 32,774,008 I5540V possibly damaging Het
Msln T C 17: 25,751,589 S231G probably benign Het
Myh8 T C 11: 67,288,353 I524T probably damaging Het
Pappa2 A G 1: 158,761,619 C1679R probably damaging Het
Pcdhb1 T C 18: 37,266,363 S456P possibly damaging Het
Pcdhga5 A G 18: 37,695,666 N389S probably benign Het
Pitrm1 C A 13: 6,567,471 S620R probably benign Het
Plod3 T A 5: 136,995,078 probably benign Het
Por A T 5: 135,730,917 Q194L probably benign Het
Prkag3 A T 1: 74,741,487 Y396N probably damaging Het
R3hcc1 T C 14: 69,697,604 probably null Het
Rcan3 C T 4: 135,425,281 S43N probably damaging Het
Rhot1 A G 11: 80,220,272 T31A probably damaging Het
Rnps1 T G 17: 24,418,512 S43A unknown Het
Rp1 T C 1: 4,346,203 D1562G possibly damaging Het
Rps19-ps13 A G 18: 40,726,375 noncoding transcript Het
Serpina3c A T 12: 104,149,512 S258T possibly damaging Het
Smc2 G A 4: 52,460,181 R519Q possibly damaging Het
Sorbs2 A T 8: 45,795,730 T593S probably benign Het
Sptbn2 A G 19: 4,737,857 T955A probably benign Het
Stfa3 T C 16: 36,452,219 K40E probably damaging Het
Tmem87b A G 2: 128,824,458 E75G probably benign Het
Tmprss15 T C 16: 79,003,410 Q595R probably benign Het
Trak1 A T 9: 121,460,412 I597F probably damaging Het
Trat1 T C 16: 48,734,937 D144G probably damaging Het
Trim25 T C 11: 88,999,532 V15A probably benign Het
Tulp1 A C 17: 28,359,060 probably null Het
Txndc15 T A 13: 55,717,921 M66K probably benign Het
Uhrf1bp1 A G 17: 27,881,556 H323R probably damaging Het
Vmn1r206 T A 13: 22,620,605 N144I probably damaging Het
Wwc2 T C 8: 47,900,761 T113A probably benign Het
Xpo5 A C 17: 46,217,609 E313D probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Other mutations in Mup8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Mup8 APN 4 60219695 missense probably damaging 0.99
IGL03102:Mup8 APN 4 60219746 missense probably benign 0.29
IGL03291:Mup8 APN 4 60221950 missense probably damaging 0.99
R5371:Mup8 UTSW 4 60222423 missense probably benign 0.00
R6006:Mup8 UTSW 4 60220403 missense probably benign 0.43
R6407:Mup8 UTSW 4 60220394 missense possibly damaging 0.78
R6931:Mup8 UTSW 4 60220322 missense probably damaging 1.00
R7172:Mup8 UTSW 4 60222425 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGTTCCTGATTTCAAACTCC -3'
(R):5'- GCACTGGTGAAACTTGGAGG -3'

Sequencing Primer
(F):5'- TTCCTGATTTCAAACTCCAGCAAAAC -3'
(R):5'- GGCAAATTTGTGATTGCTAAAGC -3'
Posted On2017-04-24