Incidental Mutation 'R5160:Zmym4'
ID475475
Institutional Source Beutler Lab
Gene Symbol Zmym4
Ensembl Gene ENSMUSG00000042446
Gene Namezinc finger, MYM-type 4
SynonymsZfp262, 6330503C17Rik
MMRRC Submission 042742-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R5160 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126861939-126968135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126870184 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1354 (N1354K)
Ref Sequence ENSEMBL: ENSMUSP00000101714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102607] [ENSMUST00000102608] [ENSMUST00000106108]
Predicted Effect probably benign
Transcript: ENSMUST00000102607
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102608
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106108
AA Change: N1354K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101714
Gene: ENSMUSG00000042446
AA Change: N1354K

DomainStartEndE-ValueType
TRASH 341 377 6.53e-4 SMART
TRASH 389 429 7.22e-6 SMART
TRASH 441 479 1.77e0 SMART
TRASH 486 525 4.95e-4 SMART
TRASH 531 569 1.05e-2 SMART
TRASH 579 615 2.82e1 SMART
low complexity region 640 649 N/A INTRINSIC
TRASH 687 723 8.49e-3 SMART
TRASH 729 764 1.14e-3 SMART
TRASH 772 810 4.48e-2 SMART
TRASH 816 851 2.06e-1 SMART
low complexity region 974 993 N/A INTRINSIC
low complexity region 1002 1021 N/A INTRINSIC
Pfam:DUF3504 1357 1527 1.7e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135003
AA Change: N1013K
SMART Domains Protein: ENSMUSP00000120813
Gene: ENSMUSG00000042446
AA Change: N1013K

DomainStartEndE-ValueType
TRASH 90 126 6.53e-4 SMART
TRASH 138 178 7.22e-6 SMART
TRASH 190 228 1.77e0 SMART
TRASH 235 274 3.05e-4 SMART
low complexity region 300 309 N/A INTRINSIC
TRASH 347 383 8.49e-3 SMART
TRASH 389 424 1.14e-3 SMART
TRASH 432 470 4.48e-2 SMART
TRASH 476 511 2.06e-1 SMART
low complexity region 634 653 N/A INTRINSIC
low complexity region 662 681 N/A INTRINSIC
Pfam:DUF3504 1017 1187 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150467
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aftph G A 11: 20,712,197 P681L probably benign Het
Akap9 A G 5: 4,030,007 R1920G probably damaging Het
Ano9 G A 7: 141,104,365 R495C probably damaging Het
Apoa5 A G 9: 46,270,496 Y290C probably damaging Het
Apob T C 12: 8,012,126 I3536T possibly damaging Het
Arhgap42 T G 9: 8,997,655 K823T probably damaging Het
Bicc1 T C 10: 70,932,236 Y850C probably damaging Het
Cdh2 A T 18: 16,629,587 D433E probably damaging Het
Cfap100 A G 6: 90,413,710 probably null Het
Col6a5 T C 9: 105,931,009 N947D unknown Het
Col8a2 A G 4: 126,310,412 K72E possibly damaging Het
Ddx18 A G 1: 121,565,879 probably null Het
Dna2 T C 10: 62,947,154 V21A probably benign Het
Dnaja3 T A 16: 4,684,288 M52K probably benign Het
Fnip2 G A 3: 79,488,991 T504I probably damaging Het
Il18 G A 9: 50,577,893 probably null Het
Ina T A 19: 47,015,080 I109N probably damaging Het
Katnb1 G T 8: 95,095,470 V275L probably benign Het
Kdm6b C A 11: 69,400,768 probably benign Het
Kifc2 T A 15: 76,662,977 L251Q probably damaging Het
Kmt2d A G 15: 98,840,224 probably benign Het
Lcor T A 19: 41,555,614 V82E probably damaging Het
Limk2 A C 11: 3,350,772 V190G probably damaging Het
Luc7l A G 17: 26,267,297 D150G probably benign Het
Magi3 T A 3: 104,027,908 H903L possibly damaging Het
Mdh1b C T 1: 63,725,645 R33Q probably null Het
Myo9a T C 9: 59,871,802 F1614L probably benign Het
Ngly1 A G 14: 16,281,751 T210A probably damaging Het
Oas1h A G 5: 120,871,082 Y285C probably damaging Het
Olfr1252 T C 2: 89,721,419 R231G probably damaging Het
Olfr1382 T C 11: 49,535,689 L168P probably damaging Het
Olfr1413 C T 1: 92,573,822 T217I probably benign Het
Olfr209 C T 16: 59,361,766 G151R probably damaging Het
Olfr364-ps1 T A 2: 37,146,803 M197K probably benign Het
Olfr91 T C 17: 37,093,724 D50G possibly damaging Het
Osbpl7 T C 11: 97,054,556 S81P probably damaging Het
Pcdha3 T C 18: 36,946,427 V74A probably damaging Het
Pi4ka T C 16: 17,323,053 D68G probably benign Het
Prkcz A T 4: 155,293,232 V79D probably benign Het
Ptpn12 T A 5: 20,997,831 I650F probably damaging Het
Rb1 A G 14: 73,264,455 silent Het
Rnaseh2b T G 14: 62,353,531 Y56* probably null Het
Ryr3 A T 2: 112,646,927 C4495S probably damaging Het
Tk1 A G 11: 117,824,746 I45T possibly damaging Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Upp1 T C 11: 9,135,193 S227P possibly damaging Het
Vmn1r30 T A 6: 58,435,383 N155Y probably benign Het
Wdr35 C T 12: 9,008,487 A548V probably damaging Het
Zc3h3 A T 15: 75,809,663 M523K probably benign Het
Zc3h4 T C 7: 16,434,648 L894P unknown Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp873 C T 10: 82,061,042 H536Y possibly damaging Het
Zscan20 A G 4: 128,592,482 S142P possibly damaging Het
Other mutations in Zmym4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zmym4 APN 4 126890058 missense probably benign
IGL00845:Zmym4 APN 4 126900613 missense probably benign 0.28
IGL01122:Zmym4 APN 4 126864252 missense probably damaging 1.00
IGL01374:Zmym4 APN 4 126868957 missense probably damaging 1.00
IGL01564:Zmym4 APN 4 126911280 missense possibly damaging 0.84
IGL02014:Zmym4 APN 4 126900669 missense possibly damaging 0.67
IGL02187:Zmym4 APN 4 126870273 missense probably damaging 0.97
IGL02887:Zmym4 APN 4 126948475 missense probably damaging 0.96
IGL03371:Zmym4 APN 4 126915088 missense possibly damaging 0.90
IGL03400:Zmym4 APN 4 126923127 missense probably benign 0.12
R0149:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0361:Zmym4 UTSW 4 126911145 missense probably benign 0.00
R0423:Zmym4 UTSW 4 126882319 splice site probably benign
R0532:Zmym4 UTSW 4 126898401 nonsense probably null
R0745:Zmym4 UTSW 4 126902703 splice site probably benign
R1183:Zmym4 UTSW 4 126925839 missense probably damaging 0.99
R1401:Zmym4 UTSW 4 126911169 missense probably benign 0.00
R1446:Zmym4 UTSW 4 126882482 missense probably damaging 1.00
R1491:Zmym4 UTSW 4 126882312 critical splice acceptor site probably null
R1566:Zmym4 UTSW 4 126911147 missense possibly damaging 0.94
R1962:Zmym4 UTSW 4 126902670 missense possibly damaging 0.47
R2398:Zmym4 UTSW 4 126923136 missense probably damaging 1.00
R2930:Zmym4 UTSW 4 126925523 missense probably benign 0.00
R3891:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R3892:Zmym4 UTSW 4 126904476 missense probably benign 0.04
R4659:Zmym4 UTSW 4 126948428 splice site probably null
R4702:Zmym4 UTSW 4 126923165 missense probably benign 0.01
R5614:Zmym4 UTSW 4 126910936 missense possibly damaging 0.75
R5773:Zmym4 UTSW 4 126905370 missense possibly damaging 0.52
R6450:Zmym4 UTSW 4 126895306 missense probably damaging 1.00
R6741:Zmym4 UTSW 4 126915085 missense possibly damaging 0.80
R7023:Zmym4 UTSW 4 126868800 missense probably damaging 1.00
R7315:Zmym4 UTSW 4 126882592 missense probably benign 0.09
U24488:Zmym4 UTSW 4 126925660 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CCGTAGTGACCAGTATGTAGG -3'
(R):5'- TTAGAAGCTGTGCAGGGCAG -3'

Sequencing Primer
(F):5'- GACCAGTATGTAGGTTCCATGATAC -3'
(R):5'- CAGATGTAAGGGACAAAACCATTTC -3'
Posted On2017-04-24