Incidental Mutation 'R5271:Vmn2r-ps159'
ID475488
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 042861-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R5271 (G1)
Quality Score30
Status Validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 156334397 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T C 3: 124,579,847 K33R possibly damaging Het
4632415L05Rik C T 3: 19,895,147 noncoding transcript Het
4930542C16Rik A C 14: 24,615,530 noncoding transcript Het
Adprh A T 16: 38,446,054 L242* probably null Het
Anapc1 G A 2: 128,685,985 Q18* probably null Het
Bfar T C 16: 13,692,397 probably benign Het
Bmp1 T C 14: 70,508,128 I206V probably benign Het
Cc2d1b T A 4: 108,623,629 probably benign Het
Clock A G 5: 76,241,954 I349T probably damaging Het
Cox11 A G 11: 90,643,732 Y60C probably damaging Het
Cyp1a1 G A 9: 57,702,838 V512M probably benign Het
Dcdc2a T C 13: 25,187,688 F311S probably benign Het
Dnase1l3 T C 14: 7,993,843 D48G probably damaging Het
Engase G T 11: 118,481,397 A172S probably damaging Het
F2 T C 2: 91,635,121 probably benign Het
Gcc2 T C 10: 58,269,695 V215A possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm14548 A T 7: 3,897,567 Y61* probably null Het
Gm20388 A G 8: 122,271,133 probably benign Het
Gm20671 T C 5: 32,819,959 K1817R possibly damaging Het
Gm20939 T A 17: 94,877,155 Y410* probably null Het
Gm27013 T C 6: 130,676,915 Y528C probably damaging Het
Gm9992 T C 17: 7,369,682 N149S possibly damaging Het
Il23r T C 6: 67,423,696 H550R probably benign Het
Iqgap1 A T 7: 80,734,148 V1056E probably damaging Het
Lrit3 T A 3: 129,788,301 Y679F probably damaging Het
Megf8 A T 7: 25,341,706 E1120V probably damaging Het
Mta1 A G 12: 113,131,957 E518G probably damaging Het
Myo9a A G 9: 59,907,382 I2200M probably damaging Het
Ncoa7 T C 10: 30,722,729 H66R probably benign Het
Ncor1 A G 11: 62,340,545 V812A probably damaging Het
Ndnf T C 6: 65,703,666 Y310H possibly damaging Het
Ndst1 G A 18: 60,705,132 T347I probably benign Het
Olfr1229 A T 2: 89,282,953 F60Y probably benign Het
Olfr512 T C 7: 108,714,217 L276S probably damaging Het
Pcdhb10 C A 18: 37,413,169 Q433K probably benign Het
Pcdhb18 G A 18: 37,491,596 V660M possibly damaging Het
Pds5b T A 5: 150,723,353 N202K possibly damaging Het
Polk T C 13: 96,483,539 S718G probably benign Het
Ptpdc1 T C 13: 48,590,698 D149G probably damaging Het
Rb1cc1 T A 1: 6,249,193 C35* probably null Het
Samd9l C T 6: 3,376,156 M368I probably benign Het
Shroom3 T C 5: 92,962,248 M1739T probably damaging Het
Slc18a3 A G 14: 32,463,748 L226P probably damaging Het
St7l A T 3: 104,868,060 Y84F probably damaging Het
Svil A T 18: 5,062,329 N392I probably benign Het
Syngr1 T A 15: 80,098,039 M9K probably benign Het
Taar2 T C 10: 23,941,032 S157P probably damaging Het
Tagap1 G T 17: 6,956,096 Y400* probably null Het
Tbc1d8 T A 1: 39,373,767 E976V probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Tnfaip2 A G 12: 111,448,460 probably benign Het
Ttn C T 2: 76,706,517 S34988N possibly damaging Het
Tubg1 T G 11: 101,120,238 N15K probably damaging Het
Zap70 T A 1: 36,781,365 V547D probably damaging Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Znrf1 T G 8: 111,609,344 M159R probably benign Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2147:Vmn2r-ps159 UTSW 4 156334719 critical splice donor site noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2510:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2899:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3106:Vmn2r-ps159 UTSW 4 156333435 intron noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5144:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
R5775:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCAGATATACATGACAAGGGCTAC -3'
(R):5'- CAGTGATGTCCATTCCAAGGTG -3'

Sequencing Primer
(F):5'- ATGACATCTTCAGCAAAGGTTG -3'
(R):5'- CCATTCCAAGGTGTTGTTGAATG -3'
Posted On2017-04-28