Incidental Mutation 'R0506:Gal3st4'
ID47574
Institutional Source Beutler Lab
Gene Symbol Gal3st4
Ensembl Gene ENSMUSG00000075593
Gene Namegalactose-3-O-sulfotransferase 4
Synonyms
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0506 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138264921-138272840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138265889 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 283 (G283S)
Ref Sequence ENSEMBL: ENSMUSP00000124841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161279] [ENSMUST00000161647]
Predicted Effect probably benign
Transcript: ENSMUST00000048421
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100530
AA Change: G283S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593
AA Change: G283S

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably benign
Transcript: ENSMUST00000159649
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect probably benign
Transcript: ENSMUST00000161279
AA Change: G283S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593
AA Change: G283S

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161647
AA Change: G278S

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593
AA Change: G278S

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galactose-3-O-sulfotransferase protein family. The product of this gene catalyzes sulfonation by transferring a sulfate to the C-3' position of galactose residues in O-linked glycoproteins. This enzyme is highly specific for core 1 structures, with asialofetuin, Gal-beta-1,3-GalNAc and Gal-beta-1,3 (GlcNAc-beta-1,6)GalNAc being good substrates. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A possibly damaging Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Gal3st4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gal3st4 APN 5 138271402 start codon destroyed probably null 0.99
IGL01916:Gal3st4 APN 5 138270935 missense probably damaging 1.00
IGL02724:Gal3st4 APN 5 138265417 missense probably benign 0.30
IGL02978:Gal3st4 APN 5 138265669 missense probably damaging 1.00
R1858:Gal3st4 UTSW 5 138270788 unclassified probably null
R1914:Gal3st4 UTSW 5 138265410 missense probably benign 0.08
R1915:Gal3st4 UTSW 5 138265410 missense probably benign 0.08
R4615:Gal3st4 UTSW 5 138266263 missense probably damaging 0.97
R4805:Gal3st4 UTSW 5 138265471 unclassified probably null
R5334:Gal3st4 UTSW 5 138265721 missense probably benign 0.01
R5442:Gal3st4 UTSW 5 138265780 missense possibly damaging 0.71
R6913:Gal3st4 UTSW 5 138270828 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CCAGTCACCACAGTCTTATTGGCAG -3'
(R):5'- TCATCGGCTTTCCGAAAGGCAC -3'

Sequencing Primer
(F):5'- ATTGGCAGTTCTGATAAGACTCTG -3'
(R):5'- AAAGGCACCGTCTTTGGC -3'
Posted On2013-06-12