Incidental Mutation 'R0506:Lyst'
ID47606
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Namelysosomal trafficking regulator
SynonymsD13Sfk13
MMRRC Submission 038701-MU
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R0506 (G1)
Quality Score154
Status Validated
Chromosome13
Chromosomal Location13590397-13778803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13638015 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1004 (H1004R)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
Predicted Effect probably benign
Transcript: ENSMUST00000110559
AA Change: H1004R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: H1004R

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223527
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A possibly damaging Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4774:Lyst UTSW 13 13740597 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCACTGCCAGTGAGCCATTAAG -3'
(R):5'- TCCCCAGGAACAGATTCAGTAGCC -3'

Sequencing Primer
(F):5'- GTGAGCCATTAAGTCACATGC -3'
(R):5'- AGTAGCCACAATCTGCTCTG -3'
Posted On2013-06-12