Incidental Mutation 'R3713:Rangap1'
ID476141
Institutional Source Beutler Lab
Gene Symbol Rangap1
Ensembl Gene ENSMUSG00000022391
Gene NameRAN GTPase activating protein 1
SynonymsFug1
MMRRC Submission 040706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3713 (G1)
Quality Score142
Status Not validated
Chromosome15
Chromosomal Location81704248-81745530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81710460 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 389 (E389D)
Ref Sequence ENSEMBL: ENSMUSP00000130046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052374] [ENSMUST00000170134] [ENSMUST00000171115] [ENSMUST00000230302]
Predicted Effect probably benign
Transcript: ENSMUST00000052374
AA Change: E389D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057771
Gene: ENSMUSG00000022391
AA Change: E389D

DomainStartEndE-ValueType
LRR 48 75 3.34e-2 SMART
LRR 111 138 4.79e-3 SMART
LRR 141 168 8.34e-3 SMART
Blast:LRR 179 206 6e-8 BLAST
LRR 207 234 9.24e1 SMART
LRR 235 262 1.13e-4 SMART
LRR 263 290 8.37e1 SMART
LRR 292 319 4.74e0 SMART
LRR 320 347 3.21e-4 SMART
low complexity region 359 399 N/A INTRINSIC
Pfam:RanGAP1_C 407 587 5.9e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170134
AA Change: E389D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126849
Gene: ENSMUSG00000022391
AA Change: E389D

DomainStartEndE-ValueType
LRR 48 75 3.34e-2 SMART
LRR 111 138 4.79e-3 SMART
LRR 141 168 8.34e-3 SMART
Blast:LRR 179 206 6e-8 BLAST
LRR 207 234 9.24e1 SMART
LRR 235 262 1.13e-4 SMART
LRR 263 290 8.37e1 SMART
LRR 292 319 4.74e0 SMART
LRR 320 347 3.21e-4 SMART
low complexity region 359 399 N/A INTRINSIC
Pfam:RanGAP1_C 406 588 7.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171115
AA Change: E389D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130046
Gene: ENSMUSG00000022391
AA Change: E389D

DomainStartEndE-ValueType
LRR 48 75 3.34e-2 SMART
LRR 111 138 4.79e-3 SMART
LRR 141 168 8.34e-3 SMART
Blast:LRR 179 206 6e-8 BLAST
LRR 207 234 9.24e1 SMART
LRR 235 262 1.13e-4 SMART
LRR 263 290 8.37e1 SMART
LRR 292 319 4.74e0 SMART
LRR 320 347 3.21e-4 SMART
low complexity region 359 399 N/A INTRINSIC
Pfam:RanGAP1_C 406 588 7.4e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229705
Predicted Effect probably benign
Transcript: ENSMUST00000230302
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the nuclear pore complex and participates in the regulation of nuclear transport. The encoded protein interacts with Ras-related nuclear protein 1 (RAN) and regulates guanosine triphosphate (GTP)-binding and exchange. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in embryo arrest at the egg cylinder stage and lethality by E8.5. The appearance of the proamniotic cavity is delayed and epiblast cells surrounding the cavity are disorganized. Mesoderm and placental development is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik T C 16: 88,627,193 M137V probably benign Het
Aak1 T A 6: 86,955,190 I381N probably benign Het
Abcd4 C T 12: 84,611,759 M223I probably benign Het
Adgrf2 A G 17: 42,713,088 V164A probably damaging Het
Ahdc1 G A 4: 133,065,986 A1513T possibly damaging Het
Akap13 T C 7: 75,586,181 M168T probably damaging Het
Aox1 C T 1: 58,056,215 T196I probably benign Het
Aqr A G 2: 114,118,669 probably benign Het
Astn1 A G 1: 158,667,532 E1042G possibly damaging Het
Azi2 A G 9: 118,047,440 D8G possibly damaging Het
Bcam T C 7: 19,764,193 T302A probably benign Het
Cct6b A T 11: 82,760,357 I110N probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Ceacam5 G A 7: 17,759,338 S762N possibly damaging Het
Cecr2 T C 6: 120,758,260 L819P probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Chd2 A G 7: 73,471,790 probably benign Het
Col7a1 G T 9: 108,964,440 G1357* probably null Het
Cux1 A G 5: 136,565,543 probably benign Het
Cwh43 A T 5: 73,438,492 I535F probably damaging Het
Dexi A T 16: 10,542,689 M1K probably null Het
Dnah12 T C 14: 26,812,790 V2081A probably benign Het
Efcab5 A T 11: 77,116,182 L872Q probably damaging Het
Enpp7 A G 11: 118,990,518 Y163C probably damaging Het
Fam221a T C 6: 49,372,614 Y38H probably damaging Het
Foxred1 A G 9: 35,210,890 M1T probably null Het
Fscn3 C T 6: 28,428,092 T26I possibly damaging Het
Galp A T 7: 6,213,837 D72V probably damaging Het
Gm9843 A G 16: 76,403,531 noncoding transcript Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Lmbrd1 T C 1: 24,692,995 Y98H probably damaging Het
Lrrc63 T G 14: 75,107,336 Y437S probably benign Het
Macc1 A G 12: 119,446,841 E448G probably benign Het
Madcam1 A G 10: 79,668,360 H404R probably benign Het
Mink1 G T 11: 70,608,950 R773L possibly damaging Het
Mroh2b A G 15: 4,943,649 I1045V probably benign Het
Mroh3 T C 1: 136,185,976 T692A probably benign Het
Myo15 A T 11: 60,479,231 E939V possibly damaging Het
Naip2 A G 13: 100,161,902 F542S probably damaging Het
Napsa A G 7: 44,581,428 Y73C probably damaging Het
Ndst4 A T 3: 125,561,505 H354L possibly damaging Het
Neil1 A T 9: 57,146,970 V22E probably damaging Het
Nol4 T C 18: 23,039,937 I36V probably damaging Het
Nprl3 G A 11: 32,255,464 T111I probably damaging Het
Olfr1184 C A 2: 88,487,443 T237N probably damaging Het
Olfr361 A G 2: 37,085,505 M81T possibly damaging Het
Olfr385 A T 11: 73,588,905 Y278N probably damaging Het
Pald1 G A 10: 61,342,365 T624I possibly damaging Het
Pcdhb13 C T 18: 37,443,733 P388L probably damaging Het
Pcdhga6 T C 18: 37,707,923 V232A probably damaging Het
Pde6b A G 5: 108,423,062 I388V probably damaging Het
Phactr2 C A 10: 13,388,732 probably benign Het
Prdx5 T C 19: 6,908,109 D56G probably damaging Het
Ptprh A T 7: 4,571,970 I350N probably damaging Het
Reln A G 5: 21,904,734 V3126A probably damaging Het
Rpl21 G A 5: 146,835,037 G59S possibly damaging Het
Rsph6a G A 7: 19,057,550 V215M probably damaging Het
Smcp T C 3: 92,584,124 K139E unknown Het
Stag1 A G 9: 100,889,618 T699A probably benign Het
Tarsl2 G A 7: 65,688,952 probably null Het
Tle1 G T 4: 72,126,422 H459Q possibly damaging Het
Ttn G A 2: 76,731,019 P27302S probably damaging Het
Ttn C T 2: 76,741,266 V26428I probably damaging Het
Usp53 T C 3: 122,949,319 E656G probably benign Het
Vmn1r218 A T 13: 23,136,911 N63Y probably damaging Het
Vmn1r79 A G 7: 12,176,212 N40S possibly damaging Het
Wdr35 A G 12: 9,027,648 D1107G possibly damaging Het
Zfp101 A G 17: 33,381,906 M292T probably benign Het
Zfp108 T A 7: 24,261,845 C620* probably null Het
Zscan4b T C 7: 10,901,891 T170A probably benign Het
Other mutations in Rangap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rangap1 APN 15 81721993 missense probably benign 0.04
IGL01080:Rangap1 APN 15 81705752 splice site probably benign
IGL01608:Rangap1 APN 15 81709504 missense probably benign 0.00
IGL01939:Rangap1 APN 15 81720663 missense probably damaging 0.97
IGL03163:Rangap1 APN 15 81716600 missense probably damaging 1.00
R0413:Rangap1 UTSW 15 81716675 frame shift probably null
R0423:Rangap1 UTSW 15 81705463 missense probably damaging 1.00
R0843:Rangap1 UTSW 15 81710502 missense probably benign
R1960:Rangap1 UTSW 15 81706503 missense probably benign 0.00
R3687:Rangap1 UTSW 15 81718762 missense possibly damaging 0.76
R3688:Rangap1 UTSW 15 81718762 missense possibly damaging 0.76
R3715:Rangap1 UTSW 15 81710460 missense probably benign 0.00
R4727:Rangap1 UTSW 15 81729755 intron probably benign
R4755:Rangap1 UTSW 15 81712917 missense probably benign 0.00
R5051:Rangap1 UTSW 15 81710463 missense probably benign 0.00
R5088:Rangap1 UTSW 15 81710463 missense probably benign 0.00
R5089:Rangap1 UTSW 15 81710463 missense probably benign 0.00
R5374:Rangap1 UTSW 15 81706494 missense probably benign 0.01
R5391:Rangap1 UTSW 15 81706446 missense probably benign 0.01
R5395:Rangap1 UTSW 15 81706446 missense probably benign 0.01
R6439:Rangap1 UTSW 15 81712135 missense probably benign
Predicted Primers
Posted On2017-05-11