Incidental Mutation 'R0507:Olfr1500'
ID47700
Institutional Source Beutler Lab
Gene Symbol Olfr1500
Ensembl Gene ENSMUSG00000054526
Gene Nameolfactory receptor 1500
SynonymsMOR212-4P, GA_x6K02T2RE5P-4160554-4159619
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13826882-13830488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13827776 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 207 (I207F)
Ref Sequence ENSEMBL: ENSMUSP00000151471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067670] [ENSMUST00000214475] [ENSMUST00000215760] [ENSMUST00000216287] [ENSMUST00000217079] [ENSMUST00000219674]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067670
AA Change: I207F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067303
Gene: ENSMUSG00000054526
AA Change: I207F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 220 9.5e-9 PFAM
Pfam:7tm_1 41 290 4.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214475
AA Change: I207F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214579
Predicted Effect possibly damaging
Transcript: ENSMUST00000215760
AA Change: I207F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216287
AA Change: I207F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217079
AA Change: I207F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219674
AA Change: I207F

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Cx3cr1 C A 9: 120,051,956 D127Y probably damaging Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mbd6 A G 10: 127,283,520 probably benign Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Ppp1r13l T C 7: 19,375,814 L720P possibly damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Thsd1 T A 8: 22,258,679 I461N probably damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Zfp512b C A 2: 181,584,964 probably benign Het
Other mutations in Olfr1500
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Olfr1500 APN 19 13828063 missense possibly damaging 0.93
IGL03122:Olfr1500 APN 19 13827650 missense possibly damaging 0.91
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0003:Olfr1500 UTSW 19 13827686 missense probably damaging 1.00
R0118:Olfr1500 UTSW 19 13827565 missense possibly damaging 0.74
R0458:Olfr1500 UTSW 19 13828229 missense probably benign 0.01
R0515:Olfr1500 UTSW 19 13827821 missense probably damaging 0.99
R0907:Olfr1500 UTSW 19 13827856 missense probably damaging 1.00
R1524:Olfr1500 UTSW 19 13828315 missense probably damaging 1.00
R2883:Olfr1500 UTSW 19 13827875 missense probably damaging 1.00
R4278:Olfr1500 UTSW 19 13828429 start gained probably benign
R4824:Olfr1500 UTSW 19 13828354 missense probably damaging 1.00
R4981:Olfr1500 UTSW 19 13828094 missense probably damaging 1.00
R5785:Olfr1500 UTSW 19 13827619 missense probably damaging 1.00
R6597:Olfr1500 UTSW 19 13828457 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GATCAGTGAGCCCTGCCACATTTAG -3'
(R):5'- GTGAGGACAATCTCAGCATTCACCC -3'

Sequencing Primer
(F):5'- AGAAGCCCTACATTGCTGG -3'
(R):5'- AGCATTCACCCTCTCTTTTTGTG -3'
Posted On2013-06-12