Incidental Mutation 'R0510:Zfp217'
ID47781
Institutional Source Beutler Lab
Gene Symbol Zfp217
Ensembl Gene ENSMUSG00000052056
Gene Namezinc finger protein 217
Synonyms4933431C08Rik
MMRRC Submission 038704-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R0510 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location170108643-170148103 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 170115462 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 539 (A539T)
Ref Sequence ENSEMBL: ENSMUSP00000104783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063710] [ENSMUST00000109155]
Predicted Effect probably benign
Transcript: ENSMUST00000063710
AA Change: A539T

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067334
Gene: ENSMUSG00000052056
AA Change: A539T

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109155
AA Change: A539T

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104783
Gene: ENSMUSG00000052056
AA Change: A539T

DomainStartEndE-ValueType
ZnF_C2H2 57 80 1.64e-1 SMART
ZnF_C2H2 121 143 9.58e-3 SMART
ZnF_C2H2 149 171 1.47e-3 SMART
ZnF_C2H2 208 230 2.91e-2 SMART
low complexity region 333 348 N/A INTRINSIC
ZnF_C2H2 383 405 1.53e-1 SMART
low complexity region 437 455 N/A INTRINSIC
ZnF_C2H2 478 500 1.36e-2 SMART
ZnF_C2H2 506 528 9.58e-3 SMART
ZnF_C2H2 704 727 2.29e0 SMART
low complexity region 854 874 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149088
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Zfp217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Zfp217 APN 2 170115149 missense probably benign
IGL02412:Zfp217 APN 2 170112502 utr 3 prime probably benign
IGL02435:Zfp217 APN 2 170119453 missense possibly damaging 0.56
IGL03152:Zfp217 APN 2 170119052 missense probably damaging 1.00
PIT4581001:Zfp217 UTSW 2 170114583 missense probably benign 0.01
R0107:Zfp217 UTSW 2 170114874 nonsense probably null
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0109:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0110:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0180:Zfp217 UTSW 2 170120137 missense probably damaging 1.00
R0200:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0279:Zfp217 UTSW 2 170119780 missense probably benign 0.28
R0395:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0396:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0453:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0512:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0513:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R0653:Zfp217 UTSW 2 170115462 missense probably benign 0.31
R1549:Zfp217 UTSW 2 170114470 missense probably benign 0.00
R3420:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3421:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3422:Zfp217 UTSW 2 170120017 missense possibly damaging 0.90
R3726:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R3731:Zfp217 UTSW 2 170114388 missense probably benign 0.31
R3926:Zfp217 UTSW 2 170112518 missense probably damaging 1.00
R4051:Zfp217 UTSW 2 170112616 critical splice acceptor site probably null
R4289:Zfp217 UTSW 2 170114787 missense probably benign 0.01
R4606:Zfp217 UTSW 2 170119750 missense possibly damaging 0.67
R4948:Zfp217 UTSW 2 170119210 missense probably damaging 0.96
R5113:Zfp217 UTSW 2 170114058 splice site probably null
R5734:Zfp217 UTSW 2 170119144 missense possibly damaging 0.57
R6228:Zfp217 UTSW 2 170119577 missense probably benign 0.01
R6452:Zfp217 UTSW 2 170119294 missense probably benign
R6782:Zfp217 UTSW 2 170116258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGTCCAGATAAGTAGGGGCAG -3'
(R):5'- AGGGAACAGCCCATGTTTGGTG -3'

Sequencing Primer
(F):5'- ATGGAAATCCTGAGTATCGTTGC -3'
(R):5'- CATAGCTTGCTTAGCTTGCAGAG -3'
Posted On2013-06-12