Incidental Mutation 'LCD18:Vps13b'
ID478063
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Namevacuolar protein sorting 13B
Synonyms2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosome15
Chromosomal Location35371160-35931229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35846957 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 2629 (A2629S)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: A2629S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: A2629S

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227567
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTAAAACAATGGCCACTGGG -3'
(R):5'- ATGCTTACCAGGGAGCATGG -3'

Sequencing Primer
(F):5'- CACTGGGCAGACAGCTG -3'
(R):5'- AGCATGGCCTGTGAGCATTC -3'
Posted On2017-05-17