Incidental Mutation 'R0510:Wdr73'
ID47807
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene NameWD repeat domain 73
Synonyms2410008B13Rik, 1200011I23Rik
MMRRC Submission 038704-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R0510 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80890723-80901269 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 80897950 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 107 (Q107*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816] [ENSMUST00000026817] [ENSMUST00000119428]
Predicted Effect probably null
Transcript: ENSMUST00000026816
AA Change: Q109*
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722
AA Change: Q109*

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026817
SMART Domains Protein: ENSMUSP00000026817
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119428
SMART Domains Protein: ENSMUSP00000113407
Gene: ENSMUSG00000025723

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Bombesin 47 60 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145923
Predicted Effect probably null
Transcript: ENSMUST00000146402
AA Change: Q107*
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722
AA Change: Q107*

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Meta Mutation Damage Score 0.678 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5046:Wdr73 UTSW 7 80892425 unclassified probably benign
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTAGACAGAAACTGTGCTGTCCCC -3'
(R):5'- TGTCTGAAAGCTGACAGACGCC -3'

Sequencing Primer
(F):5'- CACCCCGTGAACTTTACTCA -3'
(R):5'- CGCCACAGAAGTTCAGGTTTTAG -3'
Posted On2013-06-12