Incidental Mutation 'LCD18:Ppp1r3f'
ID478070
Institutional Source Beutler Lab
Gene Symbol Ppp1r3f
Ensembl Gene ENSMUSG00000039556
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3F
SynonymsDXImx48e, RF3, Sfc15
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
ChromosomeX
Chromosomal Location7557296-7574283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7560336 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 562 (G562V)
Ref Sequence ENSEMBL: ENSMUSP00000122903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115742] [ENSMUST00000150787]
Predicted Effect probably damaging
Transcript: ENSMUST00000115742
AA Change: G561V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111407
Gene: ENSMUSG00000039556
AA Change: G561V

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
low complexity region 66 96 N/A INTRINSIC
Pfam:CBM_21 147 283 5.6e-30 PFAM
low complexity region 296 316 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 585 599 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126170
Predicted Effect unknown
Transcript: ENSMUST00000132788
AA Change: G240V
SMART Domains Protein: ENSMUSP00000116002
Gene: ENSMUSG00000039556
AA Change: G240V

DomainStartEndE-ValueType
low complexity region 249 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142447
Predicted Effect probably damaging
Transcript: ENSMUST00000150787
AA Change: G562V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122903
Gene: ENSMUSG00000039556
AA Change: G562V

DomainStartEndE-ValueType
low complexity region 9 37 N/A INTRINSIC
low complexity region 66 96 N/A INTRINSIC
Pfam:CBM_21 149 283 1.3e-29 PFAM
low complexity region 296 316 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
low complexity region 586 600 N/A INTRINSIC
transmembrane domain 777 799 N/A INTRINSIC
Meta Mutation Damage Score 0.2468 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been identified as one of several type-1 protein phosphatase (PP1) regulatory subunits. One or two of these subunits, together with the well-conserved catalytic subunit, can form the PP1 holoenzyme, where the regulatory subunit functions to regulate substrate specificity and/or targeting to a particular cellular compartment. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Ppp1r3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03224:Ppp1r3f APN X 7560582 missense probably benign 0.21
FR4449:Ppp1r3f UTSW X 7560336 missense probably damaging 1.00
FR4548:Ppp1r3f UTSW X 7560336 missense probably damaging 1.00
FR4737:Ppp1r3f UTSW X 7560336 missense probably damaging 1.00
FR4976:Ppp1r3f UTSW X 7560336 missense probably damaging 1.00
R1446:Ppp1r3f UTSW X 7560363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCTATCACATCTAGAGCTAG -3'
(R):5'- AGCAGCTCTACCTGTCTCAC -3'

Sequencing Primer
(F):5'- GCTATCACATCTAGAGCTAGAGCGC -3'
(R):5'- TCTCACCTGAGCCGCTTGAG -3'
Posted On2017-05-17