Incidental Mutation 'R5205:Edem3'
ID478101
Institutional Source Beutler Lab
Gene Symbol Edem3
Ensembl Gene ENSMUSG00000043019
Gene NameER degradation enhancer, mannosidase alpha-like 3
Synonyms2310050N11Rik
MMRRC Submission 042780-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R5205 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151755371-151822051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151811519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 717 (D717V)
Ref Sequence ENSEMBL: ENSMUSP00000140234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059498] [ENSMUST00000187951] [ENSMUST00000188145] [ENSMUST00000191070]
Predicted Effect probably damaging
Transcript: ENSMUST00000059498
AA Change: D736V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058941
Gene: ENSMUSG00000043019
AA Change: D736V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.5e-118 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 672 778 9.4e-16 PFAM
low complexity region 838 855 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187951
AA Change: D718V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140775
Gene: ENSMUSG00000043019
AA Change: D718V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 1.8e-147 PFAM
low complexity region 617 630 N/A INTRINSIC
Pfam:PA 658 762 1.6e-17 PFAM
low complexity region 820 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188145
AA Change: D736V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140443
Gene: ENSMUSG00000043019
AA Change: D736V

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.3e-144 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 676 780 4.3e-15 PFAM
low complexity region 854 871 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191070
AA Change: D717V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140234
Gene: ENSMUSG00000043019
AA Change: D717V

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3e-144 PFAM
low complexity region 616 629 N/A INTRINSIC
Pfam:PA 657 761 4.1e-15 PFAM
low complexity region 824 841 N/A INTRINSIC
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,304,441 Y178* probably null Het
Adamts19 G A 18: 58,968,808 R650Q probably damaging Het
Adgre4 G T 17: 55,794,727 E216* probably null Het
Aldh6a1 T A 12: 84,439,644 M167L probably damaging Het
Asb16 G A 11: 102,268,994 D58N probably damaging Het
Cfap43 C A 19: 47,897,548 L209F possibly damaging Het
Cfh A G 1: 140,143,970 C327R probably damaging Het
Chd7 T A 4: 8,752,509 N335K possibly damaging Het
Clca3a1 T C 3: 144,746,784 E646G possibly damaging Het
Col6a6 A T 9: 105,782,033 V571D probably damaging Het
Cttnbp2 T C 6: 18,427,433 probably benign Het
Dennd1b T A 1: 139,054,568 S132T probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnaaf2 C T 12: 69,192,924 V608I probably damaging Het
Fam135a T C 1: 24,029,511 N589S probably benign Het
Gm13991 G C 2: 116,528,200 noncoding transcript Het
Gm16379 A T 9: 14,845,472 noncoding transcript Het
Ighv2-3 T C 12: 113,611,275 S87G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcna2 T C 3: 107,097,146 probably benign Het
Klra4 T A 6: 130,062,117 N104I probably damaging Het
Lrrc28 A G 7: 67,531,768 S240P probably benign Het
Majin T C 19: 6,195,759 I27T possibly damaging Het
Mfhas1 G A 8: 35,591,007 E879K probably benign Het
Msh4 A G 3: 153,866,412 L583P probably damaging Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr1477 T C 19: 13,502,799 L152P probably damaging Het
Orm1 T C 4: 63,344,692 I32T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Plppr2 A T 9: 21,941,074 T85S probably damaging Het
Ppp1r9b T A 11: 95,001,298 W604R probably benign Het
Prss56 G T 1: 87,185,534 D195Y probably damaging Het
Psme4 T A 11: 30,832,666 probably benign Het
Rbm25 T A 12: 83,672,869 D554E probably benign Het
Rbm6 A G 9: 107,788,343 M618T probably benign Het
Slc17a5 A G 9: 78,578,617 V62A probably damaging Het
Slk T A 19: 47,625,460 N918K possibly damaging Het
Syne1 C A 10: 5,052,295 A8126S probably benign Het
Synj2 T C 17: 5,941,518 L23S probably damaging Het
Taar2 A C 10: 23,940,976 H138P probably benign Het
Taar7b A T 10: 24,000,018 E27V probably benign Het
Tbc1d2b A G 9: 90,207,810 Y889H probably damaging Het
Tmem43 T C 6: 91,486,781 I346T possibly damaging Het
Ttc3 T A 16: 94,448,059 C1139S probably benign Het
Txndc11 A G 16: 11,128,665 V94A probably damaging Het
Ush2a T A 1: 188,874,936 H4009Q probably benign Het
Wnk4 A G 11: 101,265,138 E407G possibly damaging Het
Ybx1 G T 4: 119,279,151 D261E probably damaging Het
Zfp985 A T 4: 147,582,911 I79F probably damaging Het
Other mutations in Edem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Edem3 APN 1 151818513 missense probably benign
IGL01065:Edem3 APN 1 151777551 missense probably damaging 1.00
IGL01351:Edem3 APN 1 151792385 missense possibly damaging 0.95
IGL01451:Edem3 APN 1 151818628 missense probably benign 0.21
IGL01831:Edem3 APN 1 151796082 missense probably damaging 0.97
IGL02096:Edem3 APN 1 151804719 missense probably benign 0.00
IGL02207:Edem3 APN 1 151808360 missense possibly damaging 0.77
IGL02507:Edem3 APN 1 151811656 missense probably benign 0.20
IGL02690:Edem3 APN 1 151804799 missense probably damaging 1.00
R0421:Edem3 UTSW 1 151792438 splice site probably benign
R1463:Edem3 UTSW 1 151807510 missense possibly damaging 0.81
R1934:Edem3 UTSW 1 151804283 missense probably damaging 1.00
R1958:Edem3 UTSW 1 151804325 missense probably damaging 1.00
R2090:Edem3 UTSW 1 151804826 splice site probably benign
R2126:Edem3 UTSW 1 151794731 missense possibly damaging 0.76
R2191:Edem3 UTSW 1 151796883 missense probably damaging 1.00
R2211:Edem3 UTSW 1 151804702 missense possibly damaging 0.74
R4005:Edem3 UTSW 1 151759755 missense probably damaging 1.00
R4018:Edem3 UTSW 1 151804826 splice site probably benign
R4723:Edem3 UTSW 1 151804698 missense possibly damaging 0.95
R4818:Edem3 UTSW 1 151792385 missense possibly damaging 0.95
R4871:Edem3 UTSW 1 151804231 intron probably null
R5347:Edem3 UTSW 1 151807451 missense probably damaging 0.97
R5910:Edem3 UTSW 1 151770827 splice site probably null
R7021:Edem3 UTSW 1 151755672 missense probably benign 0.01
X0028:Edem3 UTSW 1 151818562 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTGCTGTACTTTCCACATACTG -3'
(R):5'- CGCTTTGTCAGAAAGGAGCAC -3'

Sequencing Primer
(F):5'- CACATACTGTTTTCTGTGTCGAG -3'
(R):5'- AGCACCTCCACCTGCTCG -3'
Posted On2017-05-25