Incidental Mutation 'R5204:Ccdc57'
ID478119
Institutional Source Beutler Lab
Gene Symbol Ccdc57
Ensembl Gene ENSMUSG00000048445
Gene Namecoiled-coil domain containing 57
Synonyms4933434G05Rik
MMRRC Submission 042779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5204 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120826529-120932872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120886062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 504 (V504A)
Ref Sequence ENSEMBL: ENSMUSP00000050996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056781
AA Change: V504A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050996
Gene: ENSMUSG00000048445
AA Change: V504A

DomainStartEndE-ValueType
coiled coil region 14 174 N/A INTRINSIC
coiled coil region 198 350 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 380 489 N/A INTRINSIC
coiled coil region 519 548 N/A INTRINSIC
coiled coil region 575 607 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
internal_repeat_1 657 677 1.17e-5 PROSPERO
low complexity region 763 774 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
internal_repeat_1 863 883 1.17e-5 PROSPERO
low complexity region 915 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G A 13: 63,033,090 V289I probably benign Het
Aarsd1 A T 11: 101,406,926 L532Q probably damaging Het
Abt1 G A 13: 23,422,668 R88C probably damaging Het
Arhgef7 T A 8: 11,800,775 L129* probably null Het
Arid1b T C 17: 5,343,041 V2282A probably damaging Het
Bivm G C 1: 44,138,578 G346A probably damaging Het
Cav1 T C 6: 17,339,255 L102P probably damaging Het
Cd7 A T 11: 121,038,034 probably null Het
Cdh3 T C 8: 106,544,239 V508A probably benign Het
Chrd A T 16: 20,736,072 I413F probably benign Het
Clec4b1 T A 6: 123,071,535 *210R probably null Het
Clock A T 5: 76,243,170 probably null Het
Col4a2 T A 8: 11,398,651 probably null Het
Gpx7 T C 4: 108,403,315 T95A probably benign Het
Hivep3 T A 4: 120,103,856 probably null Het
Hrc A G 7: 45,335,704 Y93C possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Klhl5 G T 5: 65,131,438 L14F possibly damaging Het
Mcm6 A G 1: 128,333,638 L743P probably benign Het
Nrxn1 A T 17: 90,162,364 F57Y probably damaging Het
Olfr609 C T 7: 103,492,540 V113M probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh20 G T 14: 88,468,915 D316E probably damaging Het
Pcdhb12 T A 18: 37,436,089 V96E probably damaging Het
Pi4ka A T 16: 17,359,045 L346M possibly damaging Het
Pkhd1l1 A C 15: 44,547,041 N2648T possibly damaging Het
Rufy1 C T 11: 50,406,434 R397Q probably damaging Het
Sema5a G T 15: 32,686,647 M968I probably benign Het
Slc33a1 A G 3: 63,963,746 Y149H probably damaging Het
Tln2 T A 9: 67,354,482 R658S probably benign Het
Tmem30c T C 16: 57,270,022 N274S possibly damaging Het
Tor3a A G 1: 156,655,700 L384P probably damaging Het
Trpm3 T A 19: 22,448,341 L20* probably null Het
Ttn T A 2: 76,730,212 I20955F probably damaging Het
Usp15 A T 10: 123,113,640 S908R probably benign Het
Zfp866 A G 8: 69,766,040 L310P probably damaging Het
Other mutations in Ccdc57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ccdc57 APN 11 120860469 missense possibly damaging 0.94
IGL01069:Ccdc57 APN 11 120861259 missense probably benign 0.06
IGL02065:Ccdc57 APN 11 120873760 missense possibly damaging 0.85
IGL02143:Ccdc57 APN 11 120861243 nonsense probably null
R0265:Ccdc57 UTSW 11 120921811 missense probably benign 0.00
R1184:Ccdc57 UTSW 11 120873811 splice site probably benign
R1792:Ccdc57 UTSW 11 120897881 missense possibly damaging 0.82
R1834:Ccdc57 UTSW 11 120861219 missense probably benign 0.07
R1852:Ccdc57 UTSW 11 120921673 missense probably damaging 0.98
R1914:Ccdc57 UTSW 11 120903308 splice site probably benign
R2146:Ccdc57 UTSW 11 120885225 splice site probably benign
R2341:Ccdc57 UTSW 11 120860523 missense probably benign 0.00
R3013:Ccdc57 UTSW 11 120861199 missense probably benign 0.01
R4798:Ccdc57 UTSW 11 120881857 missense possibly damaging 0.73
R4821:Ccdc57 UTSW 11 120860399 critical splice donor site probably null
R4869:Ccdc57 UTSW 11 120903518 splice site probably null
R4964:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R4966:Ccdc57 UTSW 11 120861152 missense probably benign 0.17
R5993:Ccdc57 UTSW 11 120894724 missense possibly damaging 0.85
R6072:Ccdc57 UTSW 11 120902075 missense probably damaging 0.98
R6404:Ccdc57 UTSW 11 120894712 missense probably benign 0.10
R6877:Ccdc57 UTSW 11 120873702 missense probably benign 0.00
R7074:Ccdc57 UTSW 11 120903374 missense possibly damaging 0.94
R7102:Ccdc57 UTSW 11 120921731 nonsense probably null
R7311:Ccdc57 UTSW 11 120873741 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAACACTCTTCTGGCTGGG -3'
(R):5'- CCCACCTTCGAGAAAGTGTC -3'

Sequencing Primer
(F):5'- CTCTTCTGGCTGGGCAGGG -3'
(R):5'- GGGGTCTCTTTCAAATAAGCAGC -3'
Posted On2017-05-25