Incidental Mutation 'R0510:Enpp3'
ID47825
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 3
SynonymsCD203c
MMRRC Submission 038704-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R0510 (G1)
Quality Score117
Status Validated
Chromosome10
Chromosomal Location24772406-24842823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24776781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 759 (D759E)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: D759E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: D759E

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219861
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24820597 missense probably benign 0.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24773927 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24809916 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24826195 missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24774047 missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGGGACTCCTCTCTGGAAAAGC -3'
(R):5'- CATGGGCAATTACTGGAGTGGAATGT -3'

Sequencing Primer
(F):5'- ATTGATGGCTCAGACTCTACATTTC -3'
(R):5'- ATTACTGGAGTGGAATGTGGTGC -3'
Posted On2013-06-12