Incidental Mutation 'R5367:Gm10717'
ID478265
Institutional Source Beutler Lab
Gene Symbol Gm10717
Ensembl Gene ENSMUSG00000095891
Gene Namepredicted gene 10717
Synonyms
MMRRC Submission 042945-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R5367 (G1)
Quality Score23.1
Status Validated
Chromosome9
Chromosomal Location3025417-3033289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3026317 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 205 (F205C)
Ref Sequence ENSEMBL: ENSMUSP00000096644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075573] [ENSMUST00000099042] [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099051] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000179264] [ENSMUST00000179982]
Predicted Effect probably damaging
Transcript: ENSMUST00000075573
AA Change: F205C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096644
Gene: ENSMUSG00000095891
AA Change: F205C

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.06e-10 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 177 1.06e-10 PROSPERO
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099042
SMART Domains Protein: ENSMUSP00000096640
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 47 9.09e-8 PROSPERO
transmembrane domain 76 98 N/A INTRINSIC
internal_repeat_1 117 164 9.09e-8 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099046
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099051
SMART Domains Protein: ENSMUSP00000096650
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 2 38 6.22e-5 PROSPERO
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
internal_repeat_1 118 174 6.22e-5 PROSPERO
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
AA Change: S55A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891
AA Change: S55A

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179264
SMART Domains Protein: ENSMUSP00000137451
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 43 5.09e-6 PROSPERO
transmembrane domain 69 91 N/A INTRINSIC
internal_repeat_1 117 179 5.09e-6 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 60,039,636 Y252H probably damaging Het
Aadat T C 8: 60,526,596 I164T probably damaging Het
Adam11 A G 11: 102,773,653 H389R probably benign Het
Alkbh5 G T 11: 60,538,703 R94L possibly damaging Het
Ampd3 A G 7: 110,807,871 K644R possibly damaging Het
Ankhd1 T A 18: 36,589,408 L328H probably damaging Het
Ankrd55 G T 13: 112,318,502 V45F probably damaging Het
Apol7c C A 15: 77,526,147 V200F probably damaging Het
Arap1 G A 7: 101,409,130 V721M probably damaging Het
Arhgef40 A G 14: 51,989,699 D400G probably damaging Het
Bmp4 G T 14: 46,384,493 T198K possibly damaging Het
Cblb T A 16: 52,204,653 F970L probably damaging Het
Celf5 A G 10: 81,467,264 S148P probably damaging Het
Ckap5 T A 2: 91,615,141 C1708S possibly damaging Het
Clec2l T C 6: 38,677,524 F147L possibly damaging Het
Cnksr1 T A 4: 134,230,214 I465F possibly damaging Het
Coq10b A G 1: 55,052,984 D37G probably benign Het
Cpq T G 15: 33,213,104 Y90D possibly damaging Het
Depdc1a G A 3: 159,523,954 probably null Het
Eif2ak4 T A 2: 118,436,158 probably null Het
Eif3e C T 15: 43,252,304 M355I probably damaging Het
Eif4e1b G A 13: 54,786,944 V181M probably damaging Het
Erap1 A G 13: 74,646,561 E113G probably damaging Het
Fads2 A G 19: 10,064,285 L438P probably damaging Het
Fbl T A 7: 28,175,050 V67E probably damaging Het
Gde1 A G 7: 118,705,406 L82P probably damaging Het
Gm10226 T C 17: 21,691,977 S40P possibly damaging Het
Gm1988 T A 7: 39,173,780 noncoding transcript Het
Gm6728 T C 6: 136,486,504 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Jag1 T A 2: 137,085,094 Q915L possibly damaging Het
Kdm5d G A Y: 941,645 G1282D probably benign Het
Krt83 A T 15: 101,486,994 L407Q probably damaging Het
Mlf1 A T 3: 67,393,963 H118L probably damaging Het
Mmp10 G T 9: 7,505,602 C289F probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myo9a T A 9: 59,900,449 S2029T probably damaging Het
Nap1l4 A C 7: 143,534,298 S174R probably damaging Het
Nos3 A G 5: 24,371,944 T490A probably benign Het
Olfr1000 A T 2: 85,608,374 C179S probably damaging Het
Olfr102 T A 17: 37,314,256 I43F probably damaging Het
Olfr1277 T A 2: 111,269,890 Q159L possibly damaging Het
Olfr1459 G A 19: 13,146,501 L53F probably damaging Het
Olfr76 A G 19: 12,120,436 V80A possibly damaging Het
Pdlim7 G C 13: 55,506,162 T214S probably benign Het
Piezo2 T C 18: 63,064,731 E1578G probably damaging Het
Ptcd1 T A 5: 145,147,905 probably benign Het
Sart3 C T 5: 113,759,216 probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn2 A G 11: 97,033,127 D279G possibly damaging Het
Sh2d3c A G 2: 32,745,902 D94G probably damaging Het
Slc12a4 A T 8: 105,951,634 V309E probably damaging Het
Slc1a6 A G 10: 78,787,803 E12G probably damaging Het
Smarcal1 T C 1: 72,595,976 probably null Het
Smr3a T C 5: 88,008,038 probably benign Het
Stox2 A G 8: 47,203,225 I72T probably damaging Het
Tmem234 G T 4: 129,600,707 probably benign Het
Tmem35b A G 4: 127,124,473 Q20R possibly damaging Het
Tom1l2 G A 11: 60,241,808 H430Y probably benign Het
Tpo T C 12: 30,103,290 Y355C probably damaging Het
Tulp2 A G 7: 45,516,651 N122S possibly damaging Het
Washc2 T A 6: 116,259,150 L1194H probably damaging Het
Xbp1 T C 11: 5,521,910 V12A probably benign Het
Other mutations in Gm10717
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Gm10717 APN 9 3025511 missense probably damaging 1.00
IGL01635:Gm10717 APN 9 3025506 missense possibly damaging 0.46
IGL01864:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01866:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01873:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01875:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01878:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01879:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01880:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01882:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01886:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01887:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01892:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01893:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01897:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01901:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01903:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01904:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01908:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01913:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01919:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01920:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01923:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01925:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01927:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01930:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01931:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01932:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01935:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01941:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01948:Gm10717 APN 9 3025819 missense probably damaging 1.00
IGL01949:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01951:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01952:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02106:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02142:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02592:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02609:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02802:Gm10717 UTSW 9 3031999 missense probably benign
R0277:Gm10717 UTSW 9 3025619 missense possibly damaging 0.79
R1813:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R1911:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R2399:Gm10717 UTSW 9 3025532 missense probably benign
R2874:Gm10717 UTSW 9 3025532 missense probably benign
R3617:Gm10717 UTSW 9 3025532 missense probably benign
R3720:Gm10717 UTSW 9 3025532 missense probably benign
R4988:Gm10717 UTSW 9 3026368 missense probably benign 0.00
R5002:Gm10717 UTSW 9 3025532 missense probably benign
R5117:Gm10717 UTSW 9 3025625 missense probably benign 0.00
R5539:Gm10717 UTSW 9 3030438 missense probably damaging 1.00
R5623:Gm10717 UTSW 9 3026318 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGACATTTCTAAATTTTCCACCTTT -3'
(R):5'- TGAGAAATGCACACTGTAGGACC -3'

Sequencing Primer
(F):5'- GCTATATTCCAAGTCCTACAGTGTG -3'
(R):5'- TGCACACTGTAGGACCTGGAATATG -3'
Posted On2017-06-05