Incidental Mutation 'R5458:Acrbp'
ID478269
Institutional Source Beutler Lab
Gene Symbol Acrbp
Ensembl Gene ENSMUSG00000072770
Gene Nameproacrosin binding protein
Synonymssp32, OY-TES-1
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125049689-125063267 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 125050050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000032481] [ENSMUST00000088294] [ENSMUST00000112413] [ENSMUST00000112414] [ENSMUST00000112417] [ENSMUST00000140131]
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000032481
AA Change: E14G
SMART Domains Protein: ENSMUSP00000032481
Gene: ENSMUSG00000072770
AA Change: E14G

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 140 4.8e-78 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000088294
AA Change: E14G
SMART Domains Protein: ENSMUSP00000085632
Gene: ENSMUSG00000072770
AA Change: E14G

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.6e-139 PFAM
KAZAL 466 506 1.42e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112412
SMART Domains Protein: ENSMUSP00000108031
Gene: ENSMUSG00000072770

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 87 6.5e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112413
AA Change: E14G
SMART Domains Protein: ENSMUSP00000108032
Gene: ENSMUSG00000072770
AA Change: E14G

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 169 6.2e-100 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112414
AA Change: E14G
SMART Domains Protein: ENSMUSP00000108033
Gene: ENSMUSG00000072770
AA Change: E14G

DomainStartEndE-ValueType
Pfam:PBP_sp32 1 239 1.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133695
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140883
SMART Domains Protein: ENSMUSP00000118561
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151125
SMART Domains Protein: ENSMUSP00000119709
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1.4e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
PDB:1WEU|A 167 216 3e-32 PDB
SCOP:d1fp0a1 190 216 2e-3 SMART
Blast:PHD 197 215 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to proacrosin binding protein sp32 precursor found in mouse, guinea pig, and pig. This protein is located in the sperm acrosome and is thought to function as a binding protein to proacrosin for packaging and condensation of the acrosin zymogen in the acrosomal matrix. This protein is a member of the cancer/testis family of antigens and it is found to be immunogenic. In normal tissues, this mRNA is expressed only in testis, whereas it is detected in a range of different tumor types such as bladder, breast, lung, liver, and colon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in delayed fertilization due to a delay in sperm penetration of the zona pellucida. Homozygous sperm also show reduced fertilization rates of oocytes with a thick or hardened zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Acrbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Acrbp APN 6 125050514 missense probably damaging 1.00
IGL01656:Acrbp APN 6 125053712 missense possibly damaging 0.88
IGL02095:Acrbp APN 6 125053956 nonsense probably null
IGL02186:Acrbp APN 6 125054810 splice site probably null
IGL02473:Acrbp APN 6 125054698 missense probably benign
IGL02831:Acrbp APN 6 125061249 missense possibly damaging 0.89
IGL03110:Acrbp APN 6 125062473 missense probably damaging 0.99
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0071:Acrbp UTSW 6 125050952 unclassified probably benign
R0279:Acrbp UTSW 6 125053954 critical splice donor site probably null
R0483:Acrbp UTSW 6 125054796 missense possibly damaging 0.61
R1017:Acrbp UTSW 6 125061260 splice site probably benign
R1486:Acrbp UTSW 6 125050622 missense probably damaging 1.00
R4679:Acrbp UTSW 6 125060918 missense probably damaging 0.96
R4898:Acrbp UTSW 6 125050538 missense probably damaging 0.97
R4987:Acrbp UTSW 6 125053762 missense probably benign 0.23
R5249:Acrbp UTSW 6 125060922 missense probably damaging 0.98
R5579:Acrbp UTSW 6 125061099 missense probably benign 0.00
R6491:Acrbp UTSW 6 125051479 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGCTCAGAGGAGTTCAC -3'
(R):5'- CCTGATGACTACAGTGGAAGG -3'

Sequencing Primer
(F):5'- AGTTCACCTCGTGGCCTG -3'
(R):5'- TGACTACAGTGGAAGGCTTCAAG -3'
Posted On2017-06-09