Mutagenetix > Incidental Mutation

Incidental Mutation 'U15987:Itgae'

478376

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

alpha-E1, CD103

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

U15987 (G0')

Quality Score

212.009

Status

Validated

Chromosome

Chromosomal Location

72981409-73038272 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73006400 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 356 (E356G)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006101
AA Change: E356G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: E356G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102537
AA Change: E356G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: E356G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Meta Mutation Damage Score

0.1940

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 97.1%
20x: 90.8%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	T	C	2: 152,282,790 (GRCm39)	V215A	probably damaging	Het
Abcc8	T	C	7: 45,755,268 (GRCm39)	M1511V	probably benign	Het
Abcc9	A	G	6: 142,585,301 (GRCm39)	F801S	probably damaging	Het
Abhd14a	A	T	9: 106,321,065 (GRCm39)	S97T	possibly damaging	Het
Adam39	C	T	8: 41,277,630 (GRCm39)	A7V	probably benign	Het
Adamts2	T	A	11: 50,647,533 (GRCm39)	I302N	probably damaging	Het
Akap9	T	C	5: 4,117,924 (GRCm39)		probably null	Het
Cbfa2t3	T	C	8: 123,370,236 (GRCm39)	H53R	probably benign	Het
Cdc20b	T	C	13: 113,220,576 (GRCm39)	F485S	probably damaging	Het
Ctnna1	T	C	18: 35,287,567 (GRCm39)	V92A	probably benign	Het
Dlat	A	T	9: 50,556,417 (GRCm39)		probably null	Het
Edc4	C	T	8: 106,614,180 (GRCm39)	R19C	probably benign	Het
Fam90a1b	T	C	X: 93,400,191 (GRCm39)	N213S	probably benign	Het
Gcg	A	G	2: 62,306,148 (GRCm39)	S150P	probably damaging	Het
Gk5	C	T	9: 96,058,290 (GRCm39)	Q424*	probably null	Het
Insm2	T	C	12: 55,646,799 (GRCm39)	I181T	probably damaging	Het
Kitl	G	A	10: 99,912,768 (GRCm39)		probably null	Het
Msl1	G	T	11: 98,689,519 (GRCm39)	G9C	probably benign	Het
Muc4	T	A	16: 32,575,621 (GRCm39)		probably benign	Het
Muc4	C	A	16: 32,754,529 (GRCm38)	H1468N	probably benign	Het
Myo3b	T	C	2: 70,069,243 (GRCm39)	V494A	possibly damaging	Het
Myo7a	C	T	7: 97,714,997 (GRCm39)	W1558*	probably null	Het
Nop14	T	C	5: 34,815,295 (GRCm39)	D85G	probably damaging	Het
Or1ak2	G	A	2: 36,827,241 (GRCm39)	V37I	probably benign	Het
Or5p81	T	A	7: 108,267,412 (GRCm39)	V263E	probably damaging	Het
Pgk1	C	A	X: 105,238,098 (GRCm39)	L85I	possibly damaging	Het
Pik3c2b	G	A	1: 133,002,365 (GRCm39)		probably null	Het
Plagl1	G	A	10: 13,003,490 (GRCm39)	G253R	probably damaging	Het
Ppp4r1	G	A	17: 66,121,343 (GRCm39)	V268I	possibly damaging	Het
Pramel27	T	G	4: 143,578,155 (GRCm39)	H87Q	possibly damaging	Het
Rad23b	C	T	4: 55,370,400 (GRCm39)	A142V	probably damaging	Het
Satl1	T	C	X: 111,315,613 (GRCm39)	T281A	probably benign	Het
Slc13a1	T	C	6: 24,133,656 (GRCm39)	T199A	probably benign	Het
Spmap2	A	G	10: 79,420,589 (GRCm39)	S159P	probably damaging	Het
Synrg	A	G	11: 83,915,126 (GRCm39)	E1044G	probably damaging	Het
Syt12	T	C	19: 4,506,896 (GRCm39)	D83G	probably benign	Het
Tbx5	T	C	5: 120,021,211 (GRCm39)	S406P	probably benign	Het
Tfe3	T	C	X: 7,637,288 (GRCm39)	L231P	probably damaging	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Vmn1r29	T	C	6: 58,285,080 (GRCm39)	F267L	probably benign	Het
Vmn2r79	T	A	7: 86,653,319 (GRCm39)	V528D	possibly damaging	Het
Zfp1	T	C	8: 112,396,975 (GRCm39)	F299S	probably damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,036,461 (GRCm39)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,004,520 (GRCm39)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,013,974 (GRCm39)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,010,263 (GRCm39)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,010,204 (GRCm39)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,002,585 (GRCm39)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,006,963 (GRCm39)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,009,010 (GRCm39)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	72,994,720 (GRCm39)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,024,844 (GRCm39)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	72,981,448 (GRCm39)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,009,361 (GRCm39)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,008,947 (GRCm39)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,021,777 (GRCm39)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,009,331 (GRCm39)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,009,029 (GRCm39)	splice site	probably benign
IGL02859:Itgae	APN	11	73,005,693 (GRCm39)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,016,136 (GRCm39)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,004,427 (GRCm39)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,024,680 (GRCm39)	splice site	probably null
IGL03352:Itgae	APN	11	73,022,556 (GRCm39)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,002,168 (GRCm39)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,021,825 (GRCm39)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,008,973 (GRCm39)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,014,009 (GRCm39)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,005,733 (GRCm39)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,020,032 (GRCm39)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,029,335 (GRCm39)	nonsense	probably null
R1231:Itgae	UTSW	11	73,010,205 (GRCm39)	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73,016,188 (GRCm39)	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73,006,418 (GRCm39)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,036,431 (GRCm39)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,007,988 (GRCm39)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R1915:Itgae	UTSW	11	73,009,469 (GRCm39)	splice site	probably benign
R2061:Itgae	UTSW	11	73,009,448 (GRCm39)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,036,395 (GRCm39)	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73,012,763 (GRCm39)	nonsense	probably null
R2680:Itgae	UTSW	11	73,005,752 (GRCm39)	missense	probably damaging	1.00
R2886:Itgae	UTSW	11	73,031,513 (GRCm39)	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73,004,442 (GRCm39)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,002,165 (GRCm39)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,002,960 (GRCm39)	missense	probably benign
R4212:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4213:Itgae	UTSW	11	73,010,178 (GRCm39)	missense	probably benign
R4691:Itgae	UTSW	11	73,010,345 (GRCm39)	nonsense	probably null
R4736:Itgae	UTSW	11	73,005,706 (GRCm39)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,021,821 (GRCm39)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,001,382 (GRCm39)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,036,464 (GRCm39)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,002,675 (GRCm39)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,024,734 (GRCm39)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,020,074 (GRCm39)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,036,377 (GRCm39)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,006,400 (GRCm39)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,031,583 (GRCm39)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,036,427 (GRCm39)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,022,519 (GRCm39)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,002,228 (GRCm39)	splice site	probably null
R6502:Itgae	UTSW	11	73,036,418 (GRCm39)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,009,322 (GRCm39)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,010,342 (GRCm39)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,002,195 (GRCm39)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,006,969 (GRCm39)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,002,184 (GRCm39)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,031,504 (GRCm39)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,012,786 (GRCm39)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,004,457 (GRCm39)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,014,095 (GRCm39)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,029,618 (GRCm39)	missense	probably benign
R7860:Itgae	UTSW	11	73,011,099 (GRCm39)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,024,913 (GRCm39)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,011,210 (GRCm39)	missense	probably benign
R8911:Itgae	UTSW	11	73,004,447 (GRCm39)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,016,089 (GRCm39)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,012,752 (GRCm39)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,006,906 (GRCm39)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,002,629 (GRCm39)	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73,016,182 (GRCm39)	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73,011,171 (GRCm39)	missense	possibly damaging	0.78
X0024:Itgae	UTSW	11	73,002,202 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1186:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1187:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1188:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1189:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1190:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1191:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1191:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,012,783 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,012,757 (GRCm39)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,008,913 (GRCm39)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,006,466 (GRCm39)	missense	probably benign
Z1192:Itgae	UTSW	11	72,994,786 (GRCm39)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	72,994,713 (GRCm39)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,024,953 (GRCm39)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- CTGAGGAGATACAGGTGTGTC -3'
(R):5'- ACAGCTTATGTCTCTGGGAGG -3'

Sequencing Primer
(F):5'- TGTCAGGAACACATTGCCAAAAGTG -3'
(R):5'- AGGTGGTCTCGAGGAGGATGTC -3'

Posted On

2017-06-26