Incidental Mutation 'R6002:Rabgap1'
ID478408
Institutional Source Beutler Lab
Gene Symbol Rabgap1
Ensembl Gene ENSMUSG00000035437
Gene NameRAB GTPase activating protein 1
SynonymsGapcena
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37443279-37566454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37473602 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 132 (T132A)
Ref Sequence ENSEMBL: ENSMUSP00000121963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061179] [ENSMUST00000066055] [ENSMUST00000112920] [ENSMUST00000133434] [ENSMUST00000148470]
Predicted Effect probably benign
Transcript: ENSMUST00000061179
AA Change: T132A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061624
Gene: ENSMUSG00000035437
AA Change: T132A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 1.1e-38 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066055
AA Change: T132A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000068835
Gene: ENSMUSG00000035437
AA Change: T132A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.1e-39 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112920
AA Change: T132A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108542
Gene: ENSMUSG00000035437
AA Change: T132A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 432 1.6e-35 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 473 481 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
TBC 558 770 9.27e-74 SMART
Blast:TBC 803 880 9e-33 BLAST
coiled coil region 986 1038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133434
AA Change: T132A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121963
Gene: ENSMUSG00000035437
AA Change: T132A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
PTB 138 271 2.99e-30 SMART
Pfam:DUF3694 301 433 7.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148470
AA Change: T64A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119831
Gene: ENSMUSG00000035437
AA Change: T64A

DomainStartEndE-ValueType
SCOP:d1ddma_ 68 148 2e-17 SMART
Blast:PTB 70 148 1e-51 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153145
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Rabgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Rabgap1 APN 2 37469546 missense probably damaging 1.00
IGL01456:Rabgap1 APN 2 37541175 missense probably damaging 0.99
IGL01599:Rabgap1 APN 2 37556269 missense probably damaging 1.00
IGL01834:Rabgap1 APN 2 37564761 intron probably benign
IGL01940:Rabgap1 APN 2 37487067 missense probably damaging 1.00
IGL02416:Rabgap1 APN 2 37561950 missense probably benign 0.00
IGL02683:Rabgap1 APN 2 37502939 missense probably damaging 1.00
IGL02755:Rabgap1 APN 2 37537314 missense probably damaging 0.98
IGL02999:Rabgap1 APN 2 37483826 missense possibly damaging 0.56
IGL03144:Rabgap1 APN 2 37540532 missense probably damaging 0.99
IGL02796:Rabgap1 UTSW 2 37472306 missense probably damaging 0.99
R0117:Rabgap1 UTSW 2 37561885 splice site probably null
R0455:Rabgap1 UTSW 2 37487120 missense probably damaging 1.00
R0569:Rabgap1 UTSW 2 37489717 intron probably benign
R0586:Rabgap1 UTSW 2 37543223 missense probably benign
R0962:Rabgap1 UTSW 2 37560469 intron probably benign
R1055:Rabgap1 UTSW 2 37492068 missense possibly damaging 0.91
R1086:Rabgap1 UTSW 2 37469446 missense probably damaging 0.99
R1251:Rabgap1 UTSW 2 37543234 splice site probably null
R1598:Rabgap1 UTSW 2 37561899 missense probably damaging 1.00
R1924:Rabgap1 UTSW 2 37495759 critical splice donor site probably null
R1957:Rabgap1 UTSW 2 37483762 missense possibly damaging 0.93
R2134:Rabgap1 UTSW 2 37563487 nonsense probably null
R2154:Rabgap1 UTSW 2 37475441 missense probably damaging 1.00
R4328:Rabgap1 UTSW 2 37532615 missense probably damaging 1.00
R4351:Rabgap1 UTSW 2 37483782 missense probably benign
R4658:Rabgap1 UTSW 2 37487549 nonsense probably null
R4821:Rabgap1 UTSW 2 37532519 missense probably damaging 1.00
R4897:Rabgap1 UTSW 2 37560571 missense probably benign 0.01
R5014:Rabgap1 UTSW 2 37487140 missense probably damaging 1.00
R5252:Rabgap1 UTSW 2 37475357 missense probably benign 0.11
R5392:Rabgap1 UTSW 2 37469489 missense probably damaging 1.00
R5794:Rabgap1 UTSW 2 37502902 missense probably benign 0.03
R5941:Rabgap1 UTSW 2 37561896 missense possibly damaging 0.62
R6209:Rabgap1 UTSW 2 37563598 nonsense probably null
R6317:Rabgap1 UTSW 2 37542647 missense possibly damaging 0.88
R7011:Rabgap1 UTSW 2 37540480 missense probably damaging 1.00
R7014:Rabgap1 UTSW 2 37560563 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCAGGTCACATTTTCAGTTTGG -3'
(R):5'- AGATACATTCGGCACTGAGAG -3'

Sequencing Primer
(F):5'- AGAGTTCCATCTAGTATGAGTTGC -3'
(R):5'- TACATTCGGCACTGAGAGGGTTAC -3'
Posted On2017-06-26