Incidental Mutation 'R6002:Pcyox1'
ID478420
Institutional Source Beutler Lab
Gene Symbol Pcyox1
Ensembl Gene ENSMUSG00000029998
Gene Nameprenylcysteine oxidase 1
Synonyms1200015P13Rik, Pcly, PCL1
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location86386006-86397154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86392182 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 152 (M152L)
Ref Sequence ENSEMBL: ENSMUSP00000119449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032065] [ENSMUST00000153723] [ENSMUST00000204116]
Predicted Effect probably benign
Transcript: ENSMUST00000032065
AA Change: M221L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032065
Gene: ENSMUSG00000029998
AA Change: M221L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 8.2e-13 PFAM
Pfam:Amino_oxidase 44 346 7.1e-9 PFAM
Pfam:Prenylcys_lyase 128 501 8.1e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129650
Predicted Effect unknown
Transcript: ENSMUST00000131500
AA Change: M54L
SMART Domains Protein: ENSMUSP00000122602
Gene: ENSMUSG00000029998
AA Change: M54L

DomainStartEndE-ValueType
Pfam:Prenylcys_lyase 1 73 6.1e-25 PFAM
Pfam:Prenylcys_lyase 69 197 7.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153723
AA Change: M152L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000119449
Gene: ENSMUSG00000029998
AA Change: M152L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Prenylcys_lyase 59 181 5.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203960
Predicted Effect probably benign
Transcript: ENSMUST00000204116
SMART Domains Protein: ENSMUSP00000145474
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 4.9e-12 PFAM
Pfam:Amino_oxidase 44 136 3.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product (Tschantz et al., 1999 [PubMed 10585463]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious pathology despite a striking accumulation of both farnesylcysteine and geranylgeranylcysteine in brain and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Pcyox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Pcyox1 APN 6 86388753 missense probably damaging 1.00
IGL02008:Pcyox1 APN 6 86392268 missense probably benign 0.01
IGL02655:Pcyox1 APN 6 86389344 missense probably damaging 1.00
R0690:Pcyox1 UTSW 6 86394442 missense probably damaging 1.00
R4631:Pcyox1 UTSW 6 86389143 missense probably benign 0.00
R4631:Pcyox1 UTSW 6 86389230 missense possibly damaging 0.96
R4976:Pcyox1 UTSW 6 86388726 missense probably damaging 1.00
R5227:Pcyox1 UTSW 6 86391744 missense probably damaging 0.98
R5288:Pcyox1 UTSW 6 86392354 splice site probably null
R5408:Pcyox1 UTSW 6 86392298 missense probably damaging 1.00
R5862:Pcyox1 UTSW 6 86391674 critical splice donor site probably null
R6123:Pcyox1 UTSW 6 86388928 missense possibly damaging 0.88
R6290:Pcyox1 UTSW 6 86388899 missense probably benign 0.24
R6766:Pcyox1 UTSW 6 86394408 critical splice donor site probably null
R7047:Pcyox1 UTSW 6 86388909 missense probably damaging 1.00
R7066:Pcyox1 UTSW 6 86394496 missense probably damaging 1.00
R7139:Pcyox1 UTSW 6 86394537 missense possibly damaging 0.50
R7268:Pcyox1 UTSW 6 86391731 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGCTCAGGTGAAAGCCAC -3'
(R):5'- TTGCAAGGATCTACCGTTACCAG -3'

Sequencing Primer
(F):5'- GCTCAGGTGAAAGCCACTGAAAC -3'
(R):5'- GGATCTACCGTTACCAGTCCCATG -3'
Posted On2017-06-26