Incidental Mutation 'R6002:Prl5a1'
ID478435
Institutional Source Beutler Lab
Gene Symbol Prl5a1
Ensembl Gene ENSMUSG00000017064
Gene Nameprolactin family 5, subfamily a, member 1
SynonymsD13Wsu14e, 1600013P04Rik, Prlpl, PLP-L
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location28142484-28151611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28145482 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 48 (I48T)
Ref Sequence ENSEMBL: ENSMUSP00000017208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017208]
Predicted Effect probably benign
Transcript: ENSMUST00000017208
AA Change: I48T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000017208
Gene: ENSMUSG00000017064
AA Change: I48T

DomainStartEndE-ValueType
Pfam:Hormone_1 17 230 4.8e-50 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Prl5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Prl5a1 APN 13 28145439 missense possibly damaging 0.77
IGL01820:Prl5a1 APN 13 28148700 missense probably benign 0.34
IGL02682:Prl5a1 APN 13 28145420 missense probably benign 0.32
R0266:Prl5a1 UTSW 13 28149987 missense possibly damaging 0.77
R1022:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R1024:Prl5a1 UTSW 13 28149897 missense probably damaging 0.97
R2098:Prl5a1 UTSW 13 28145505 missense probably damaging 1.00
R5467:Prl5a1 UTSW 13 28150011 missense possibly damaging 0.92
R6026:Prl5a1 UTSW 13 28151264 missense probably benign 0.43
R6242:Prl5a1 UTSW 13 28142555 nonsense probably null
R6616:Prl5a1 UTSW 13 28149856 missense probably benign 0.00
R6733:Prl5a1 UTSW 13 28149936 missense possibly damaging 0.81
R6979:Prl5a1 UTSW 13 28151206 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TAACAGAGGACACGGTGGCT -3'
(R):5'- GCTTTCTTGAGCCTATGAATGTGTA -3'

Sequencing Primer
(F):5'- GCTAGACAGGGTTTCACTATACAGC -3'
(R):5'- AGCCTATGAATGTGTATTGTTTGG -3'
Posted On2017-06-26