Incidental Mutation 'R6003:Ccdc3'
ID478449
Institutional Source Beutler Lab
Gene Symbol Ccdc3
Ensembl Gene ENSMUSG00000026676
Gene Namecoiled-coil domain containing 3
Synonyms
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location5137776-5230878 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 5141407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027988]
Predicted Effect probably null
Transcript: ENSMUST00000027988
SMART Domains Protein: ENSMUSP00000027988
Gene: ENSMUSG00000026676

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 188 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180479
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Aging mice homozygous for a null allele are lean and show decreased epididymal and subcutaneous adipose tissue weight and adipocyte size, mild hyperglycemia, increased insulin sensitivity, reduced liver triglyceride levels and steatosis, and fewer inflammatory cells in epididymal fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Ccdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Ccdc3 UTSW 2 5138205 missense probably damaging 1.00
R1164:Ccdc3 UTSW 2 5141266 missense possibly damaging 0.95
R1808:Ccdc3 UTSW 2 5138085 missense probably damaging 1.00
R3832:Ccdc3 UTSW 2 5229142 missense probably benign 0.18
R5686:Ccdc3 UTSW 2 5138060 missense probably damaging 1.00
R5878:Ccdc3 UTSW 2 5229016 missense probably benign 0.27
R6053:Ccdc3 UTSW 2 5229027 missense probably benign 0.22
R6987:Ccdc3 UTSW 2 5138304 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGCCTCACCAATGTGTCTGC -3'
(R):5'- CCTTGAGCATGCAATAATGTCC -3'

Sequencing Primer
(F):5'- CCCCTTCAGGATGGATGAGAATTAC -3'
(R):5'- AATGTCCACTAGTATGTGCACTGC -3'
Posted On2017-06-26