Incidental Mutation 'R6003:Ints2'
ID478473
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86238468 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 460 (E460G)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: E460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: E460G

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: E460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: E460G

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGACTAAGTCAATGATAGCACTAAGCT -3'
(R):5'- AGTCTTTAAGAATGAGGAAAAGCTG -3'

Sequencing Primer
(F):5'- GCTGGTTGCTATGGAAATACATG -3'
(R):5'- CCATCGGTAATGAGATCTGATGCC -3'
Posted On2017-06-26