Incidental Mutation 'R6004:Dnah3'
ID478510
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120086297 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 164 (D164G)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect probably benign
Transcript: ENSMUST00000046993
AA Change: D164G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: D164G

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: D165G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213993
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 intron probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5789:Dnah3 UTSW 7 119943599 missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 unclassified probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCAGGTGACTCTCATTTG -3'
(R):5'- TGACATGCACACATCAGATGC -3'

Sequencing Primer
(F):5'- CTCTTTAGAATCACTCAGATGCCGAG -3'
(R):5'- GCACACATCAGATGCCACTAGATG -3'
Posted On2017-06-26