Incidental Mutation 'R6015:Aqr'
List |< first << previous [record 86 of 1308] next >> last >|
ID478546
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6015 (G1)
Quality Score92.0077
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 114175165 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000099602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect probably null
Transcript: ENSMUST00000043160
AA Change: M1T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: M1T

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102543
AA Change: M1T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154317
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,958 L280S probably damaging Het
Ano5 A C 7: 51,574,777 S480R probably benign Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Moxd2 A T 6: 40,883,754 Y310N probably damaging Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Parp3 C T 9: 106,474,282 V207M possibly damaging Het
Pfkfb3 T C 2: 11,481,335 probably null Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Psapl1 T C 5: 36,204,250 V62A probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r40 C A 6: 89,714,606 A135D probably damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGTGGTCTAACGAGGAGC -3'
(R):5'- TAGTTCTGCTTCCGGGGAAC -3'

Sequencing Primer
(F):5'- AGGAGCGGCCTCTTTCACTG -3'
(R):5'- AACGCCGGGACTTCTCAG -3'
Posted On2017-06-26