Incidental Mutation 'R6015:Atxn2'
ID 478554
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Name ataxin 2
Synonyms 9630045M23Rik, ATX2, Sca2
MMRRC Submission 043254-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R6015 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 121849672-121954372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121949055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 817 (V817D)
Ref Sequence ENSEMBL: ENSMUSP00000124070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000086310] [ENSMUST00000136960] [ENSMUST00000160220] [ENSMUST00000160462] [ENSMUST00000161064] [ENSMUST00000162327] [ENSMUST00000161159]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051950
AA Change: V1144D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605
AA Change: V1144D

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086310
SMART Domains Protein: ENSMUSP00000083490
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2e-22 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
SH2 334 419 3.53e-19 SMART
low complexity region 512 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136960
SMART Domains Protein: ENSMUSP00000119086
Gene: ENSMUSG00000042594

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Pfam:Phe_ZIP 22 77 2.4e-23 PFAM
low complexity region 114 128 N/A INTRINSIC
PH 168 281 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159928
Predicted Effect probably benign
Transcript: ENSMUST00000160220
SMART Domains Protein: ENSMUSP00000124059
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160462
AA Change: V58D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124092
Gene: ENSMUSG00000042605
AA Change: V58D

DomainStartEndE-ValueType
low complexity region 42 52 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161064
AA Change: V817D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605
AA Change: V817D

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162327
AA Change: V520D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605
AA Change: V520D

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161159
AA Change: V122D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123833
Gene: ENSMUSG00000042605
AA Change: V122D

DomainStartEndE-ValueType
low complexity region 74 111 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161433
Predicted Effect probably benign
Transcript: ENSMUST00000199864
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A C 7: 51,224,525 (GRCm39) S480R probably benign Het
Aqr A G 2: 114,005,646 (GRCm39) M1T probably null Het
Arhgef28 A G 13: 98,211,530 (GRCm39) V151A possibly damaging Het
Atp6v1b2 T A 8: 69,555,148 (GRCm39) I170N probably damaging Het
Cdh23 A C 10: 60,143,761 (GRCm39) I2950S probably damaging Het
Ces1h A G 8: 94,083,691 (GRCm39) L417P unknown Het
Cimap3 T C 3: 105,906,937 (GRCm39) D154G possibly damaging Het
Csf1r A G 18: 61,242,784 (GRCm39) E49G possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fat3 A G 9: 16,287,346 (GRCm39) S726P possibly damaging Het
Grik2 A T 10: 49,399,959 (GRCm39) probably null Het
Il9r A G 11: 32,142,674 (GRCm39) V287A probably benign Het
Inpp5b T C 4: 124,692,143 (GRCm39) C909R possibly damaging Het
Kat7 G A 11: 95,174,860 (GRCm39) H384Y probably damaging Het
Lama5 A G 2: 179,827,185 (GRCm39) S2272P probably benign Het
Megf10 A G 18: 57,386,100 (GRCm39) H371R probably benign Het
Moxd2 A T 6: 40,860,688 (GRCm39) Y310N probably damaging Het
Ntrk2 A T 13: 59,208,209 (GRCm39) E685V probably damaging Het
Ogfr G T 2: 180,236,467 (GRCm39) G351W probably damaging Het
Or52ac1 G T 7: 104,245,915 (GRCm39) P158T probably damaging Het
Parp3 C T 9: 106,351,481 (GRCm39) V207M possibly damaging Het
Pfkfb3 T C 2: 11,486,146 (GRCm39) probably null Het
Pigr T C 1: 130,774,998 (GRCm39) V475A probably benign Het
Pik3ap1 T A 19: 41,316,640 (GRCm39) Y250F probably benign Het
Ppp1r3c A T 19: 36,711,206 (GRCm39) I188N probably damaging Het
Prmt7 T G 8: 106,961,640 (GRCm39) probably benign Het
Psapl1 T C 5: 36,361,594 (GRCm39) V62A probably benign Het
Relch T C 1: 105,619,683 (GRCm39) L280S probably damaging Het
Rpp14 G A 14: 8,090,462 (GRCm38) V129I probably benign Het
Sema4f A G 6: 82,916,553 (GRCm39) probably benign Het
Serpinb13 C A 1: 106,928,337 (GRCm39) A319E probably benign Het
Sez6l2 A T 7: 126,552,625 (GRCm39) S134C probably damaging Het
Slc4a10 T A 2: 62,059,046 (GRCm39) H184Q probably benign Het
Slc9a9 G T 9: 94,821,602 (GRCm39) A330S probably benign Het
Sord T C 2: 122,087,424 (GRCm39) V176A probably damaging Het
Ssbp2 G T 13: 91,817,862 (GRCm39) probably null Het
Stab2 G T 10: 86,773,906 (GRCm39) N808K probably damaging Het
Syne1 A G 10: 5,296,819 (GRCm39) probably null Het
Tpcn2 A G 7: 144,820,588 (GRCm39) V341A probably damaging Het
Unc13b C A 4: 43,177,995 (GRCm39) S2941* probably null Het
Utrn T A 10: 12,354,168 (GRCm39) H2806L possibly damaging Het
Vmn1r40 C A 6: 89,691,588 (GRCm39) A135D probably damaging Het
Vmn1r68 C T 7: 10,261,616 (GRCm39) V161M probably benign Het
Wiz T A 17: 32,606,574 (GRCm39) I54F probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121,933,118 (GRCm39) missense probably benign 0.00
IGL00798:Atxn2 APN 5 121,933,298 (GRCm39) missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121,949,042 (GRCm39) missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121,935,407 (GRCm39) missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121,944,331 (GRCm39) nonsense probably null
IGL02122:Atxn2 APN 5 121,916,093 (GRCm39) missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121,919,450 (GRCm39) missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121,919,399 (GRCm39) missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121,948,972 (GRCm39) missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121,923,298 (GRCm39) missense probably benign 0.00
R0387:Atxn2 UTSW 5 121,940,206 (GRCm39) missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121,910,841 (GRCm39) missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121,885,484 (GRCm39) splice site probably null
R1305:Atxn2 UTSW 5 121,887,247 (GRCm39) missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121,941,145 (GRCm39) critical splice donor site probably null
R1471:Atxn2 UTSW 5 121,924,437 (GRCm39) missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121,917,654 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,951,593 (GRCm39) missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121,940,171 (GRCm39) missense probably damaging 0.99
R2083:Atxn2 UTSW 5 121,922,069 (GRCm39) missense probably benign 0.00
R2197:Atxn2 UTSW 5 121,944,280 (GRCm39) splice site probably null
R2217:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121,941,140 (GRCm39) missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121,940,142 (GRCm39) critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121,919,456 (GRCm39) missense probably damaging 1.00
R3706:Atxn2 UTSW 5 121,923,931 (GRCm39) critical splice donor site probably null
R4604:Atxn2 UTSW 5 121,919,406 (GRCm39) missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121,952,474 (GRCm39) missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121,887,159 (GRCm39) missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121,952,406 (GRCm39) missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121,933,098 (GRCm39) splice site probably null
R5213:Atxn2 UTSW 5 121,952,543 (GRCm39) splice site probably null
R5655:Atxn2 UTSW 5 121,885,489 (GRCm39) missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121,951,512 (GRCm39) missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121,935,373 (GRCm39) missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121,917,495 (GRCm39) missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121,949,677 (GRCm39) critical splice donor site probably null
R6659:Atxn2 UTSW 5 121,916,027 (GRCm39) missense probably benign 0.10
R6864:Atxn2 UTSW 5 121,917,557 (GRCm39) missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121,949,530 (GRCm39) nonsense probably null
R7166:Atxn2 UTSW 5 121,934,460 (GRCm39) missense possibly damaging 0.90
R7253:Atxn2 UTSW 5 121,916,084 (GRCm39) missense probably damaging 1.00
R7257:Atxn2 UTSW 5 121,923,880 (GRCm39) missense possibly damaging 0.62
R7467:Atxn2 UTSW 5 121,940,330 (GRCm39) critical splice donor site probably null
R7544:Atxn2 UTSW 5 121,919,431 (GRCm39) missense probably damaging 1.00
R7648:Atxn2 UTSW 5 121,934,440 (GRCm39) missense probably damaging 0.99
R7883:Atxn2 UTSW 5 121,940,180 (GRCm39) missense possibly damaging 0.79
R8097:Atxn2 UTSW 5 121,887,286 (GRCm39) missense probably damaging 1.00
R8784:Atxn2 UTSW 5 121,933,091 (GRCm39) missense probably benign 0.00
R8835:Atxn2 UTSW 5 121,940,248 (GRCm39) missense possibly damaging 0.63
R8880:Atxn2 UTSW 5 121,948,973 (GRCm39) missense probably benign 0.24
R8983:Atxn2 UTSW 5 121,916,063 (GRCm39) missense probably damaging 1.00
R9254:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9332:Atxn2 UTSW 5 121,923,425 (GRCm39) missense probably damaging 1.00
R9379:Atxn2 UTSW 5 121,885,509 (GRCm39) missense probably damaging 1.00
R9412:Atxn2 UTSW 5 121,940,201 (GRCm39) missense possibly damaging 0.84
R9649:Atxn2 UTSW 5 121,949,055 (GRCm39) missense probably damaging 0.98
R9656:Atxn2 UTSW 5 121,922,061 (GRCm39) missense possibly damaging 0.78
X0028:Atxn2 UTSW 5 121,940,146 (GRCm39) missense probably benign 0.01
Z1176:Atxn2 UTSW 5 121,916,053 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAATTAGGCATAGTGGGC -3'
(R):5'- CCAACAGGAAGGCAGCATTG -3'

Sequencing Primer
(F):5'- CAGTGGTCGTCAGAATTGTACAC -3'
(R):5'- GCGGCTTGCCTTCAGGAATG -3'
Posted On 2017-06-26