Incidental Mutation 'R6015:Vmn1r40'
ID478557
Institutional Source Beutler Lab
Gene Symbol Vmn1r40
Ensembl Gene ENSMUSG00000096051
Gene Namevomeronasal 1 receptor 40
SynonymsV1rb7
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6015 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location89707540-89716657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89714606 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 135 (A135D)
Ref Sequence ENSEMBL: ENSMUSP00000154581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075158] [ENSMUST00000226925] [ENSMUST00000227669] [ENSMUST00000228485] [ENSMUST00000228642]
Predicted Effect probably damaging
Transcript: ENSMUST00000075158
AA Change: A135D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074655
Gene: ENSMUSG00000096051
AA Change: A135D

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 3.4e-143 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226925
AA Change: A135D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000227669
Predicted Effect probably benign
Transcript: ENSMUST00000228485
Predicted Effect probably damaging
Transcript: ENSMUST00000228642
AA Change: A135D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,958 L280S probably damaging Het
Ano5 A C 7: 51,574,777 S480R probably benign Het
Aqr A G 2: 114,175,165 M1T probably null Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Moxd2 A T 6: 40,883,754 Y310N probably damaging Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Parp3 C T 9: 106,474,282 V207M possibly damaging Het
Pfkfb3 T C 2: 11,481,335 probably null Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Psapl1 T C 5: 36,204,250 V62A probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in Vmn1r40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Vmn1r40 APN 6 89714596 missense probably damaging 0.99
IGL01432:Vmn1r40 APN 6 89714219 missense probably benign
IGL01777:Vmn1r40 APN 6 89714222 missense probably benign 0.38
IGL01834:Vmn1r40 APN 6 89714572 missense possibly damaging 0.62
IGL01908:Vmn1r40 APN 6 89714309 missense probably damaging 0.97
IGL01908:Vmn1r40 APN 6 89714303 missense probably benign 0.00
IGL01999:Vmn1r40 APN 6 89714966 missense probably benign 0.00
IGL02728:Vmn1r40 APN 6 89715016 missense probably benign 0.05
IGL03169:Vmn1r40 APN 6 89715023 missense probably damaging 0.97
R0448:Vmn1r40 UTSW 6 89714660 missense probably benign 0.23
R0971:Vmn1r40 UTSW 6 89714290 missense probably benign 0.00
R1208:Vmn1r40 UTSW 6 89714344 missense probably benign 0.13
R1208:Vmn1r40 UTSW 6 89714344 missense probably benign 0.13
R1448:Vmn1r40 UTSW 6 89714576 missense probably damaging 1.00
R1739:Vmn1r40 UTSW 6 89714315 missense probably benign 0.00
R2170:Vmn1r40 UTSW 6 89714975 missense probably benign 0.11
R3151:Vmn1r40 UTSW 6 89714566 missense probably benign 0.01
R3804:Vmn1r40 UTSW 6 89715009 missense probably benign 0.29
R5098:Vmn1r40 UTSW 6 89714948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGGGACTCATAGCTGTGGAC -3'
(R):5'- CTGACAAGAAAGGCTTCCCTG -3'

Sequencing Primer
(F):5'- ACTCATAGCTGTGGACATGTTTC -3'
(R):5'- CAAGAAAGGCTTCCCTGATGGC -3'
Posted On2017-06-26