Incidental Mutation 'R6016:Tnks1bp1'
ID478588
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6016 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85052390 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 187 (L187P)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111605]
Predicted Effect probably damaging
Transcript: ENSMUST00000111605
AA Change: L187P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: L187P

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTACCCAAGAGTCTGGGAAGG -3'
(R):5'- TGAGCCCACTTCCTCCATAG -3'

Sequencing Primer
(F):5'- AGAAGACTTGCCCCCTCTC -3'
(R):5'- TAGCCCCTTTAAGACTTCAAGG -3'
Posted On2017-06-26