Incidental Mutation 'R6016:Vmn1r157'
ID478599
Institutional Source Beutler Lab
Gene Symbol Vmn1r157
Ensembl Gene ENSMUSG00000095619
Gene Namevomeronasal 1 receptor 157
SynonymsVmn1r109, Gm4517, Gm8699
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6016 (G1)
Quality Score113.008
Status Not validated
Chromosome7
Chromosomal Location22761697-22762590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22761847 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 51 (R51G)
Ref Sequence ENSEMBL: ENSMUSP00000137271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178215]
Predicted Effect possibly damaging
Transcript: ENSMUST00000178215
AA Change: R51G

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137271
Gene: ENSMUSG00000095619
AA Change: R51G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 175 192 N/A INTRINSIC
transmembrane domain 196 214 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
transmembrane domain 262 284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Vmn1r157
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5253:Vmn1r157 UTSW 7 22761758 missense probably damaging 1.00
R7249:Vmn1r157 UTSW 7 22761700 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGGTTGAATAAAGGCCTCTCC -3'
(R):5'- GGGACACTTGCTCTGAGTATAAG -3'

Sequencing Primer
(F):5'- GGTTGAATAAAGGCCTCTCCATGTC -3'
(R):5'- CTGATGGACACTCAGGACACAG -3'
Posted On2017-06-26