Incidental Mutation 'R6016:Gm17067'
ID478601
Institutional Source Beutler Lab
Gene Symbol Gm17067
Ensembl Gene ENSMUSG00000091594
Gene Namepredicted gene 17067
Synonyms
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6016 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42705469-42727017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42708230 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 283 (P283T)
Ref Sequence ENSEMBL: ENSMUSP00000128086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166837] [ENSMUST00000180131]
Predicted Effect probably benign
Transcript: ENSMUST00000166837
AA Change: P283T

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128086
Gene: ENSMUSG00000091594
AA Change: P283T

DomainStartEndE-ValueType
KRAB 4 66 4.19e-17 SMART
ZnF_C2H2 131 153 1.28e-3 SMART
ZnF_C2H2 159 181 9.73e-4 SMART
ZnF_C2H2 187 209 1.03e-2 SMART
ZnF_C2H2 215 237 1.28e-3 SMART
ZnF_C2H2 243 265 1.38e-3 SMART
ZnF_C2H2 271 293 1.04e-3 SMART
ZnF_C2H2 299 321 8.47e-4 SMART
ZnF_C2H2 327 349 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180131
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Gm17067
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Gm17067 APN 7 42710676 critical splice donor site probably null
R0016:Gm17067 UTSW 7 42708622 missense probably benign 0.05
R0445:Gm17067 UTSW 7 42708622 missense probably benign 0.00
R3911:Gm17067 UTSW 7 42710680 missense possibly damaging 0.51
R4380:Gm17067 UTSW 7 42708038 missense probably benign 0.00
R5502:Gm17067 UTSW 7 42708419 missense probably damaging 0.97
R5557:Gm17067 UTSW 7 42708521 missense probably damaging 1.00
R5602:Gm17067 UTSW 7 42708415 missense probably damaging 0.98
R5875:Gm17067 UTSW 7 42708046 missense probably benign 0.00
R6029:Gm17067 UTSW 7 42708130 missense probably benign 0.06
R6360:Gm17067 UTSW 7 42708482 missense probably benign
R6562:Gm17067 UTSW 7 42708729 missense probably damaging 1.00
R6892:Gm17067 UTSW 7 42710675 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTCATCACACTGATTACATAT -3'
(R):5'- GTGGTAAGGCCTTTGCACA -3'

Sequencing Primer
(F):5'- AGAGTCTCCCTCCAGTATGTATTAC -3'
(R):5'- GTGATAAAGCCTTTGCACAGCTC -3'
Posted On2017-06-26