Incidental Mutation 'R0512:Lamc3'
ID47870
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Namelaminin gamma 3
Synonyms
MMRRC Submission 038706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0512 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31887291-31946539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31937968 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1378 (L1378Q)
Ref Sequence ENSEMBL: ENSMUSP00000028187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect probably damaging
Transcript: ENSMUST00000028187
AA Change: L1378Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: L1378Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138325
AA Change: L1389Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: L1389Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 114,863,508 M22R probably benign Het
Abca8b C A 11: 109,950,650 M1039I probably benign Het
Actn2 A T 13: 12,277,415 I653N probably damaging Het
Actr8 G T 14: 29,978,556 V31L probably benign Het
Adam30 T C 3: 98,162,125 C425R probably damaging Het
Armc1 A G 3: 19,149,495 V89A possibly damaging Het
Atr T C 9: 95,935,526 M2090T probably damaging Het
Braf T A 6: 39,664,989 probably benign Het
Cant1 A T 11: 118,411,265 N75K probably benign Het
Chd7 C T 4: 8,805,139 probably benign Het
Clec16a A G 16: 10,614,580 Y488C probably damaging Het
Col6a3 A T 1: 90,821,798 probably benign Het
Col9a2 T A 4: 121,054,307 M615K probably benign Het
D3Ertd254e T C 3: 36,166,113 C762R probably damaging Het
Dedd G A 1: 171,340,930 R228H probably damaging Het
Dhtkd1 C T 2: 5,904,091 D731N probably damaging Het
Ercc2 A G 7: 19,393,887 T651A probably damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fam193a T C 5: 34,426,391 S19P probably damaging Het
Fam208a T C 14: 27,446,406 F302L probably damaging Het
Fam43a T C 16: 30,601,735 V379A possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fat1 C A 8: 44,951,332 Y373* probably null Het
Fbxl15 A C 19: 46,329,422 D181A probably damaging Het
Flt3 A T 5: 147,341,270 C831* probably null Het
Foxj3 T A 4: 119,585,836 probably benign Het
Glul T C 1: 153,905,386 probably benign Het
Gm16380 A T 9: 53,884,245 noncoding transcript Het
Gm7964 A T 7: 83,755,950 noncoding transcript Het
Hipk1 A G 3: 103,760,574 F559S possibly damaging Het
Hnf4g A T 3: 3,651,622 I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icosl A G 10: 78,071,966 N120S possibly damaging Het
Ift172 A G 5: 31,285,477 V155A possibly damaging Het
Kdm4c A G 4: 74,333,794 E426G probably benign Het
Kif23 A G 9: 61,918,975 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,779,134 C1456Y possibly damaging Het
Larp1b T A 3: 40,970,034 L121M probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lepr A C 4: 101,814,704 D975A possibly damaging Het
Magi1 A G 6: 93,694,064 V1068A probably damaging Het
Malt1 T A 18: 65,458,200 N358K probably damaging Het
Mfap4 T A 11: 61,487,945 W240R probably damaging Het
Mis18a A G 16: 90,726,356 V84A possibly damaging Het
Mns1 A G 9: 72,449,471 E308G possibly damaging Het
Mpp2 C A 11: 102,062,290 L258F possibly damaging Het
Myh2 A G 11: 67,188,678 E987G probably damaging Het
Myof A G 19: 37,954,524 V702A possibly damaging Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Nrxn2 A G 19: 6,517,198 T1360A probably damaging Het
Obox6 A G 7: 15,833,949 I191T probably benign Het
Pacs2 G T 12: 113,050,927 R236L probably damaging Het
Pcdhb2 T G 18: 37,295,979 V335G probably damaging Het
Phyhipl T C 10: 70,568,918 I140M probably damaging Het
Pkhd1 T C 1: 20,310,514 probably benign Het
Ppp1r3b T G 8: 35,384,417 C137G probably damaging Het
Prdm13 T A 4: 21,678,490 I667F probably damaging Het
Prex2 A G 1: 11,199,933 M1281V probably benign Het
Rab40b A G 11: 121,359,586 F81L probably damaging Het
Rb1cc1 T C 1: 6,248,543 S729P probably damaging Het
Rcl1 A G 19: 29,128,097 D228G probably damaging Het
Rhbdf1 A T 11: 32,210,875 C19* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf150 G A 8: 82,864,178 V57M probably benign Het
Rp9 A G 9: 22,458,719 F51L probably benign Het
Sav1 A T 12: 69,969,201 Y274* probably null Het
Scn4a A T 11: 106,345,677 D252E probably damaging Het
Scn5a T C 9: 119,550,658 T187A probably damaging Het
Sigirr T A 7: 141,092,420 D229V probably benign Het
Slc39a13 T C 2: 91,065,686 S157G possibly damaging Het
Slc6a20a A G 9: 123,660,406 S191P probably damaging Het
Sorl1 C A 9: 42,067,832 A457S probably benign Het
Spag5 A G 11: 78,319,586 probably benign Het
Spon1 A G 7: 113,836,833 E119G possibly damaging Het
Spred2 T A 11: 20,008,485 probably benign Het
Sprr3 T G 3: 92,457,477 Q20P possibly damaging Het
Strn3 A T 12: 51,627,183 F464L possibly damaging Het
Sun1 A G 5: 139,234,847 probably benign Het
Sypl2 A G 3: 108,226,170 W28R possibly damaging Het
Syt5 A T 7: 4,542,814 V150D probably damaging Het
Thsd7a A G 6: 12,379,605 I940T possibly damaging Het
Tnrc6a T A 7: 123,186,728 probably benign Het
Trp53 T A 11: 69,588,683 L203Q probably damaging Het
Tubgcp4 T C 2: 121,175,419 V96A probably benign Het
Usp17la A G 7: 104,861,039 T284A possibly damaging Het
Usp34 T C 11: 23,451,997 M2409T probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r56 A G 7: 12,715,423 I296T probably benign Het
Vmn2r67 A G 7: 85,150,692 V446A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31900581 missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31918521 missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31914656 missense probably benign 0.07
IGL01086:Lamc3 APN 2 31898476 missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31912107 missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31898278 missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31887655 missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31914604 splice site probably benign
IGL02340:Lamc3 APN 2 31918457 missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31905965 missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31920662 missense probably benign 0.00
IGL02679:Lamc3 APN 2 31945398 missense probably benign 0.01
IGL02751:Lamc3 APN 2 31920704 missense probably benign 0.07
IGL02820:Lamc3 APN 2 31923022 missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31935725 splice site probably benign
IGL02926:Lamc3 APN 2 31935726 splice site probably benign
IGL03090:Lamc3 APN 2 31908698 splice site probably benign
IGL03258:Lamc3 APN 2 31887683 missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31922428 missense probably benign 0.07
R0137:Lamc3 UTSW 2 31908616 missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31915084 splice site probably benign
R0244:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31928802 missense probably benign 0.03
R1142:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31928847 missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31887411 missense probably benign
R1515:Lamc3 UTSW 2 31940751 missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31915996 missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31921781 missense probably null 0.01
R1707:Lamc3 UTSW 2 31912129 critical splice donor site probably null
R1714:Lamc3 UTSW 2 31940757 missense probably benign 0.02
R1838:Lamc3 UTSW 2 31925582 missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31940702 missense probably benign 0.02
R3177:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31924592 missense probably benign 0.01
R4065:Lamc3 UTSW 2 31945258 missense probably benign 0.00
R4089:Lamc3 UTSW 2 31920508 nonsense probably null
R4373:Lamc3 UTSW 2 31898232 missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31931952 missense probably benign
R4395:Lamc3 UTSW 2 31931952 missense probably benign
R4397:Lamc3 UTSW 2 31931952 missense probably benign
R4746:Lamc3 UTSW 2 31905614 missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31940736 missense probably benign 0.02
R4960:Lamc3 UTSW 2 31915954 missense probably benign 0.00
R5025:Lamc3 UTSW 2 31908669 missense probably benign 0.13
R5062:Lamc3 UTSW 2 31905667 missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31887344 start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31918596 missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31931985 missense probably benign
R5655:Lamc3 UTSW 2 31925717 missense probably benign 0.01
R5928:Lamc3 UTSW 2 31921709 missense probably benign 0.00
R6018:Lamc3 UTSW 2 31905712 missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31887401 missense probably benign
R6601:Lamc3 UTSW 2 31920532 missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31908689 missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31938069 missense probably benign
R7114:Lamc3 UTSW 2 31930645 missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31930702 missense probably benign 0.39
X0010:Lamc3 UTSW 2 31938012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTTGAGAAGGGGCCACATAG -3'
(R):5'- AAACCCGAGAAAGCTGCTGCTG -3'

Sequencing Primer
(F):5'- GGGCCACATAGATCTCCTCTG -3'
(R):5'- AGAAAGCTGCTGCTGTCCTG -3'
Posted On2013-06-12