Incidental Mutation 'R6019:Pde4b'
ID478771
Institutional Source Beutler Lab
Gene Symbol Pde4b
Ensembl Gene ENSMUSG00000028525
Gene Namephosphodiesterase 4B, cAMP specific
Synonymsdunce, Dpde4
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R6019 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location102087543-102607259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102570769 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 41 (E41G)
Ref Sequence ENSEMBL: ENSMUSP00000095562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097950] [ENSMUST00000106904] [ENSMUST00000106908] [ENSMUST00000106911]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097950
AA Change: E41G

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095562
Gene: ENSMUSG00000028525
AA Change: E41G

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
HDc 231 406 2.35e-5 SMART
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106904
AA Change: E136G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102517
Gene: ENSMUSG00000028525
AA Change: E136G

DomainStartEndE-ValueType
HDc 326 501 2.35e-5 SMART
low complexity region 608 621 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106908
AA Change: E198G

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102521
Gene: ENSMUSG00000028525
AA Change: E198G

DomainStartEndE-ValueType
HDc 388 563 2.35e-5 SMART
low complexity region 670 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106911
AA Change: E213G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525
AA Change: E213G

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
HDc 403 578 2.35e-5 SMART
low complexity region 685 698 N/A INTRINSIC
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Pde4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Pde4b APN 4 102506044 critical splice donor site probably null
IGL01146:Pde4b APN 4 102255263 missense possibly damaging 0.80
IGL01377:Pde4b APN 4 102487402 missense probably damaging 1.00
IGL01549:Pde4b APN 4 102605068 missense probably damaging 0.97
IGL01739:Pde4b APN 4 102601635 missense probably damaging 0.97
IGL01791:Pde4b APN 4 102590930 splice site probably benign
IGL02211:Pde4b APN 4 102590822 splice site probably benign
IGL02578:Pde4b APN 4 102255297 missense possibly damaging 0.94
IGL02878:Pde4b APN 4 102601639 missense probably damaging 1.00
PIT4458001:Pde4b UTSW 4 102602678 missense probably damaging 1.00
PIT4618001:Pde4b UTSW 4 102602812 missense probably benign 0.09
R0102:Pde4b UTSW 4 102590178 missense probably benign 0.15
R0230:Pde4b UTSW 4 102597510 missense probably benign 0.01
R0530:Pde4b UTSW 4 102602651 missense probably damaging 0.96
R0704:Pde4b UTSW 4 102487392 missense probably damaging 0.99
R1115:Pde4b UTSW 4 102542155 intron probably benign
R1450:Pde4b UTSW 4 102601635 missense probably damaging 0.97
R1457:Pde4b UTSW 4 102605176 missense probably damaging 0.99
R1568:Pde4b UTSW 4 102597699 missense probably damaging 1.00
R1740:Pde4b UTSW 4 102487351 missense probably damaging 1.00
R1784:Pde4b UTSW 4 102605260 missense probably benign 0.02
R1960:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R1961:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R2033:Pde4b UTSW 4 102605295 missense probably benign 0.43
R2210:Pde4b UTSW 4 102597475 missense probably damaging 1.00
R2848:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R2936:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3195:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3196:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3695:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3699:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R4014:Pde4b UTSW 4 102555625 missense probably benign 0.00
R4627:Pde4b UTSW 4 102601605 missense probably damaging 1.00
R4852:Pde4b UTSW 4 102597770 missense probably damaging 1.00
R5055:Pde4b UTSW 4 102195114 intron probably benign
R5109:Pde4b UTSW 4 102601544 missense probably damaging 1.00
R5319:Pde4b UTSW 4 102421788 utr 3 prime probably benign
R5476:Pde4b UTSW 4 102602699 missense probably benign 0.00
R5576:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6151:Pde4b UTSW 4 102601551 missense probably damaging 1.00
R6540:Pde4b UTSW 4 102601876 missense probably damaging 1.00
R6573:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6662:Pde4b UTSW 4 102601898 missense possibly damaging 0.82
R6751:Pde4b UTSW 4 102602671 missense probably damaging 0.98
R7066:Pde4b UTSW 4 102602806 missense probably benign 0.03
R7092:Pde4b UTSW 4 102601851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGATCACTGACACCTCATC -3'
(R):5'- TTCGACCAAGTCAACAGACAGG -3'

Sequencing Primer
(F):5'- GTGAAAACTTGGCACCCGC -3'
(R):5'- TTTGAAGCCATCTCGCTG -3'
Posted On2017-06-26