Incidental Mutation 'R6019:Gsr'
ID478796
Institutional Source Beutler Lab
Gene Symbol Gsr
Ensembl Gene ENSMUSG00000031584
Gene Nameglutathione reductase
SynonymsD8Ertd238e, Gr-1, Gr1
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6019 (G1)
Quality Score189.009
Status Validated
Chromosome8
Chromosomal Location33652523-33698163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33693807 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 366 (A366S)
Ref Sequence ENSEMBL: ENSMUSP00000033992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033992]
Predicted Effect probably damaging
Transcript: ENSMUST00000033992
AA Change: A366S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033992
Gene: ENSMUSG00000031584
AA Change: A366S

DomainStartEndE-ValueType
low complexity region 17 22 N/A INTRINSIC
Pfam:Pyr_redox_2 43 368 1.2e-73 PFAM
Pfam:Pyr_redox 211 292 1.7e-21 PFAM
Pfam:Pyr_redox_dim 389 500 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158231
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]
PHENOTYPE: A homozygous mutation disrupting this gene between exon 1-2 results in a decreased retinal artery-to-vein ratio. Another small deletion of exons 2-5 has no phenotypic effect. Electrophoretic alleles designated a (C57BL/6, CE) vs. allele b (SJL, SWR) are known. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Gsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Gsr APN 8 33682584 splice site probably benign
IGL02481:Gsr APN 8 33685541 splice site probably benign
IGL02941:Gsr APN 8 33689425 missense probably damaging 0.98
IGL03242:Gsr APN 8 33685599 missense probably benign
IGL03293:Gsr APN 8 33694996 splice site probably benign
R0208:Gsr UTSW 8 33689355 missense possibly damaging 0.45
R0490:Gsr UTSW 8 33671512 splice site probably benign
R0492:Gsr UTSW 8 33681575 splice site probably benign
R0524:Gsr UTSW 8 33669180 critical splice donor site probably null
R1104:Gsr UTSW 8 33669921 missense probably damaging 1.00
R1976:Gsr UTSW 8 33680260 splice site probably null
R2507:Gsr UTSW 8 33680288 missense probably benign 0.45
R2508:Gsr UTSW 8 33680288 missense probably benign 0.45
R3726:Gsr UTSW 8 33671537 missense probably benign 0.11
R4573:Gsr UTSW 8 33693853 missense probably benign 0.00
R4623:Gsr UTSW 8 33680305 missense probably damaging 0.99
R4639:Gsr UTSW 8 33697256 missense probably damaging 1.00
R4713:Gsr UTSW 8 33680319 critical splice donor site probably null
R4717:Gsr UTSW 8 33693858 nonsense probably null
R4992:Gsr UTSW 8 33693913 missense probably damaging 1.00
R5099:Gsr UTSW 8 33671528 missense probably damaging 1.00
R7046:Gsr UTSW 8 33695062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGCAGTAATGCTAGGTCTTC -3'
(R):5'- AACTGCAGACTAAACAGAGGGTTC -3'

Sequencing Primer
(F):5'- GCAGTAATGCTAGGTCTTCATTATG -3'
(R):5'- GACTAAACAGAGGGTTCCTGTAACTC -3'
Posted On2017-06-26