Incidental Mutation 'R6020:Zfhx3'
ID478869
Institutional Source Beutler Lab
Gene Symbol Zfhx3
Ensembl Gene ENSMUSG00000038872
Gene Namezinc finger homeobox 3
SynonymsA230102L03Rik, Atbf1, WBP9
Accession Numbers

Genbank: NM_007496

Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6020 (G1)
Quality Score218.009
Status Not validated
Chromosome8
Chromosomal Location107942644-108961630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108792527 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 94 (Y94H)
Ref Sequence ENSEMBL: ENSMUSP00000152353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000188994] [ENSMUST00000220518]
Predicted Effect probably damaging
Transcript: ENSMUST00000043896
AA Change: Y94H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: Y94H

DomainStartEndE-ValueType
ZnF_C2H2 79 103 7.89e0 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
ZnF_C2H2 282 305 1.36e1 SMART
low complexity region 393 411 N/A INTRINSIC
coiled coil region 453 496 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
ZnF_C2H2 641 664 3.47e0 SMART
ZnF_C2H2 672 695 6.78e-3 SMART
ZnF_U1 724 758 5.71e-1 SMART
ZnF_C2H2 727 751 4.87e-4 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 796 804 N/A INTRINSIC
ZnF_C2H2 805 829 6.67e-2 SMART
ZnF_U1 982 1016 2.35e0 SMART
ZnF_C2H2 985 1009 4.57e0 SMART
ZnF_C2H2 1041 1065 3.99e0 SMART
ZnF_U1 1086 1120 1.36e0 SMART
ZnF_C2H2 1089 1113 1.33e-1 SMART
ZnF_C2H2 1233 1256 4.11e-2 SMART
ZnF_C2H2 1262 1285 4.34e-1 SMART
ZnF_C2H2 1370 1395 1.08e-1 SMART
ZnF_C2H2 1411 1433 3.34e-2 SMART
ZnF_C2H2 1439 1462 8.09e-1 SMART
low complexity region 1500 1512 N/A INTRINSIC
ZnF_U1 1552 1586 1.05e0 SMART
ZnF_C2H2 1555 1579 8.22e-2 SMART
ZnF_U1 1603 1637 4.19e0 SMART
ZnF_C2H2 1606 1630 1.16e-1 SMART
low complexity region 1643 1669 N/A INTRINSIC
low complexity region 1734 1776 N/A INTRINSIC
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1842 1878 N/A INTRINSIC
low complexity region 1881 1894 N/A INTRINSIC
low complexity region 1967 1985 N/A INTRINSIC
ZnF_C2H2 1990 2013 1.62e0 SMART
low complexity region 2041 2088 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
HOX 2152 2214 1.13e-16 SMART
HOX 2249 2311 2.41e-20 SMART
ZnF_C2H2 2335 2355 1.72e1 SMART
low complexity region 2383 2414 N/A INTRINSIC
low complexity region 2458 2473 N/A INTRINSIC
low complexity region 2476 2521 N/A INTRINSIC
ZnF_C2H2 2539 2561 1.79e-2 SMART
low complexity region 2606 2619 N/A INTRINSIC
HOX 2650 2712 2.97e-20 SMART
ZnF_C2H2 2720 2743 7.67e-2 SMART
low complexity region 2929 2950 N/A INTRINSIC
HOX 2954 3016 1.07e-17 SMART
ZnF_U1 3029 3063 1.8e-1 SMART
ZnF_C2H2 3032 3056 8.31e0 SMART
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3181 3235 N/A INTRINSIC
low complexity region 3237 3256 N/A INTRINSIC
low complexity region 3268 3282 N/A INTRINSIC
low complexity region 3290 3299 N/A INTRINSIC
coiled coil region 3362 3417 N/A INTRINSIC
low complexity region 3452 3476 N/A INTRINSIC
ZnF_C2H2 3489 3509 1.45e2 SMART
ZnF_U1 3546 3580 1.36e0 SMART
ZnF_C2H2 3549 3573 1.77e1 SMART
low complexity region 3602 3633 N/A INTRINSIC
low complexity region 3642 3674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188994
Predicted Effect probably damaging
Transcript: ENSMUST00000220518
AA Change: Y94H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]
Allele List at MGI

 All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,145,613 V557F possibly damaging Het
Abi3 A T 11: 95,842,025 L41* probably null Het
Actn1 C A 12: 80,174,455 probably null Het
Adamts15 G T 9: 30,902,062 R936S probably benign Het
Angel2 T C 1: 190,932,871 S22P probably benign Het
Ank2 T G 3: 126,946,821 probably benign Het
Astn1 A G 1: 158,509,993 D423G probably damaging Het
Casp9 A G 4: 141,796,538 D78G probably damaging Het
Cbr4 A G 8: 61,487,853 D2G probably benign Het
Ccdc8 T A 7: 16,996,581 L665H probably damaging Het
Cdh23 T A 10: 60,331,326 N1847I probably damaging Het
Cnst T C 1: 179,609,875 W335R probably benign Het
Ddr2 T A 1: 170,005,102 I130F probably benign Het
Dnah2 C T 11: 69,500,839 A677T probably benign Het
Dzip3 C A 16: 48,951,842 W488L probably damaging Het
Ephb3 T G 16: 21,222,013 I637S probably damaging Het
Etv3 A G 3: 87,529,364 D142G probably benign Het
Fabp5 C T 3: 10,016,089 T126I probably benign Het
Fam13b A C 18: 34,494,774 Y125D probably damaging Het
Fsip2 C A 2: 82,992,127 P6068Q probably damaging Het
Gm11232 A G 4: 71,756,668 F199S possibly damaging Het
Gm340 G A 19: 41,583,547 G247D possibly damaging Het
Gm5493 A G 17: 22,748,061 K57E probably benign Het
Gm7334 A G 17: 50,699,237 M184V probably benign Het
Gm9894 T C 13: 67,763,835 noncoding transcript Het
Gpd2 T A 2: 57,364,513 N674K probably benign Het
H2-M10.6 A G 17: 36,813,067 Y141C probably damaging Het
Heatr5a C T 12: 51,884,327 E1796K probably benign Het
Hexim2 A G 11: 103,138,292 T57A probably benign Het
Hrg A T 16: 22,954,518 N134Y probably damaging Het
Hsd17b12 T C 2: 94,033,977 T262A probably damaging Het
Irak3 G T 10: 120,143,137 P470T probably damaging Het
Itgbl1 A T 14: 123,846,565 D285V probably damaging Het
Kcp A T 6: 29,502,864 V164E probably benign Het
Klhdc7b T A 15: 89,388,386 M1157K probably damaging Het
Mdc1 G A 17: 35,848,633 G635D probably benign Het
Mdc1 A G 17: 35,857,572 K1690R probably benign Het
Mpp3 A T 11: 102,018,539 probably benign Het
Ncor2 G T 5: 125,020,011 H2285N probably benign Het
Neb T A 2: 52,257,827 T2727S probably benign Het
Nkx6-2 T C 7: 139,581,567 D234G possibly damaging Het
Nlrp9c T C 7: 26,384,725 I476M probably benign Het
Nrsn1 T G 13: 25,253,372 Q191P probably damaging Het
Olfr116 A T 17: 37,623,967 S223T possibly damaging Het
Olfr390 C T 11: 73,787,552 L205F probably benign Het
Olfr610 T A 7: 103,506,799 H49L probably benign Het
Patl1 T G 19: 11,937,354 L623R probably damaging Het
Pdc T C 1: 150,333,366 I200T probably benign Het
Pdzk1 A G 3: 96,868,426 D370G probably benign Het
Pglyrp3 A T 3: 92,031,534 I339F probably damaging Het
Plxnb1 T C 9: 109,116,611 V2070A probably damaging Het
Poln G A 5: 34,109,431 R461C probably damaging Het
Prl2b1 C A 13: 27,383,508 V218L probably damaging Het
Pygl T C 12: 70,216,654 D55G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
RP24-351P7.8 T C 7: 11,610,301 F62S probably damaging Het
Rsrp1 T C 4: 134,924,381 F152S probably damaging Het
Sim2 T C 16: 94,097,251 S115P probably damaging Het
Slc17a1 T A 13: 23,875,610 I108K possibly damaging Het
Slc30a8 A G 15: 52,325,658 D223G probably damaging Het
Slc39a4 A T 15: 76,616,142 N69K probably benign Het
Slc51a T G 16: 32,479,766 T58P probably damaging Het
Slc7a14 T C 3: 31,224,112 H448R probably benign Het
Smc3 G A 19: 53,625,163 probably null Het
Sox6 A T 7: 115,486,628 D659E probably damaging Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tsr1 C T 11: 74,900,293 probably null Het
Ttc12 T C 9: 49,443,122 K565E probably damaging Het
Ube4b A T 4: 149,368,311 V386E probably benign Het
Ush2a T A 1: 188,728,096 probably null Het
Usp5 C A 6: 124,817,613 probably benign Het
Vmn1r216 T C 13: 23,099,935 F263L probably benign Het
Vmn2r88 T A 14: 51,418,149 L606* probably null Het
Wee2 T A 6: 40,449,620 probably null Het
Zfp385c G A 11: 100,632,768 P120L probably benign Het
Other mutations in Zfhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfhx3 APN 8 108793594 missense probably benign 0.00
IGL01946:Zfhx3 APN 8 108933929 missense probably damaging 0.98
IGL01973:Zfhx3 APN 8 108947193 missense probably damaging 1.00
IGL01983:Zfhx3 APN 8 108947234 missense probably damaging 1.00
IGL02151:Zfhx3 APN 8 108793883 missense probably damaging 1.00
IGL02405:Zfhx3 APN 8 108955742 missense unknown
IGL02406:Zfhx3 APN 8 108955742 missense unknown
IGL02408:Zfhx3 APN 8 108955372 splice site probably benign
IGL02549:Zfhx3 APN 8 108800509 missense probably damaging 1.00
IGL02601:Zfhx3 APN 8 108856830 missense probably damaging 1.00
IGL02649:Zfhx3 APN 8 108793535 missense possibly damaging 0.94
IGL03027:Zfhx3 APN 8 108793188 missense probably damaging 0.98
IGL03053:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03168:Zfhx3 APN 8 108946500 missense probably damaging 0.99
IGL03194:Zfhx3 APN 8 108794727 missense probably damaging 0.97
IGL03248:Zfhx3 APN 8 108946550 missense probably damaging 1.00
FR4449:Zfhx3 UTSW 8 108956094 small insertion probably benign
FR4589:Zfhx3 UTSW 8 108956101 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956088 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956102 small insertion probably benign
FR4737:Zfhx3 UTSW 8 108956103 small insertion probably benign
G5030:Zfhx3 UTSW 8 108951459 missense possibly damaging 0.86
R0016:Zfhx3 UTSW 8 108950178 missense probably benign 0.02
R0090:Zfhx3 UTSW 8 108950057 missense possibly damaging 0.85
R0330:Zfhx3 UTSW 8 108948957 missense probably damaging 1.00
R0332:Zfhx3 UTSW 8 108946623 missense probably damaging 1.00
R0398:Zfhx3 UTSW 8 108951246 missense probably damaging 0.98
R0539:Zfhx3 UTSW 8 108800509 missense probably damaging 1.00
R0546:Zfhx3 UTSW 8 108794187 missense probably damaging 1.00
R0614:Zfhx3 UTSW 8 108948539 missense probably benign 0.03
R0614:Zfhx3 UTSW 8 108948967 nonsense probably null
R0653:Zfhx3 UTSW 8 108946808 missense possibly damaging 0.95
R0718:Zfhx3 UTSW 8 108955650 missense unknown
R0825:Zfhx3 UTSW 8 108949208 missense probably damaging 0.99
R1143:Zfhx3 UTSW 8 108794411 missense probably damaging 1.00
R1319:Zfhx3 UTSW 8 108933833 missense probably damaging 0.99
R1347:Zfhx3 UTSW 8 108800698 splice site probably benign
R1412:Zfhx3 UTSW 8 108914567 missense possibly damaging 0.88
R1447:Zfhx3 UTSW 8 108948444 missense probably benign 0.03
R1530:Zfhx3 UTSW 8 108948489 missense probably damaging 1.00
R1745:Zfhx3 UTSW 8 108955862 missense unknown
R1764:Zfhx3 UTSW 8 108951644 missense probably benign 0.18
R1781:Zfhx3 UTSW 8 108793535 missense probably benign 0.01
R1917:Zfhx3 UTSW 8 108956248 missense unknown
R1956:Zfhx3 UTSW 8 108794142 missense probably benign 0.02
R2049:Zfhx3 UTSW 8 108945177 missense probably benign 0.01
R2196:Zfhx3 UTSW 8 108800253 missense probably damaging 1.00
R3085:Zfhx3 UTSW 8 108956032 missense unknown
R3765:Zfhx3 UTSW 8 108792762 missense probably damaging 0.97
R4162:Zfhx3 UTSW 8 108956987 missense unknown
R4243:Zfhx3 UTSW 8 108792320 missense probably damaging 0.97
R4380:Zfhx3 UTSW 8 108956390 missense unknown
R4433:Zfhx3 UTSW 8 108955637 missense unknown
R4509:Zfhx3 UTSW 8 108793779 missense probably benign 0.01
R4731:Zfhx3 UTSW 8 108956084 missense unknown
R4788:Zfhx3 UTSW 8 108794210 missense probably damaging 1.00
R4812:Zfhx3 UTSW 8 108947961 missense possibly damaging 0.83
R4893:Zfhx3 UTSW 8 108957007 missense unknown
R4907:Zfhx3 UTSW 8 108793354 missense probably damaging 0.99
R4935:Zfhx3 UTSW 8 108947850 missense possibly damaging 0.92
R4943:Zfhx3 UTSW 8 108948317 missense probably damaging 0.98
R5154:Zfhx3 UTSW 8 108800575 missense probably damaging 1.00
R5377:Zfhx3 UTSW 8 108951185 missense possibly damaging 0.95
R5388:Zfhx3 UTSW 8 108946814 missense possibly damaging 0.88
R5434:Zfhx3 UTSW 8 108792399 missense probably damaging 0.99
R5445:Zfhx3 UTSW 8 108956210 missense unknown
R5541:Zfhx3 UTSW 8 108948951 missense probably damaging 0.99
R5571:Zfhx3 UTSW 8 108955991 missense unknown
R5700:Zfhx3 UTSW 8 108933867 missense probably damaging 1.00
R5754:Zfhx3 UTSW 8 108800332 missense probably damaging 0.99
R5867:Zfhx3 UTSW 8 108793446 missense probably damaging 1.00
R5905:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R5922:Zfhx3 UTSW 8 108946698 missense probably damaging 1.00
R5972:Zfhx3 UTSW 8 108950851 missense possibly damaging 0.91
R6028:Zfhx3 UTSW 8 108793503 missense probably damaging 1.00
R6113:Zfhx3 UTSW 8 108947421 missense probably benign 0.04
R6253:Zfhx3 UTSW 8 108955388 missense possibly damaging 0.96
R6356:Zfhx3 UTSW 8 108946619 missense probably damaging 1.00
R6800:Zfhx3 UTSW 8 108949517 missense probably benign 0.20
R6829:Zfhx3 UTSW 8 108950283 missense probably damaging 0.98
R6872:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6873:Zfhx3 UTSW 8 108800641 missense probably damaging 1.00
R6919:Zfhx3 UTSW 8 108800528 missense probably damaging 1.00
R6921:Zfhx3 UTSW 8 108951392 missense possibly damaging 0.53
R6925:Zfhx3 UTSW 8 108956821 missense unknown
R6927:Zfhx3 UTSW 8 108956821 missense unknown
R7152:Zfhx3 UTSW 8 108948207 missense possibly damaging 0.94
R7169:Zfhx3 UTSW 8 108951398 missense possibly damaging 0.86
R7214:Zfhx3 UTSW 8 108948861 missense probably damaging 0.98
X0019:Zfhx3 UTSW 8 108951653 missense probably benign 0.00
X0026:Zfhx3 UTSW 8 108949145 missense probably damaging 1.00
Z1088:Zfhx3 UTSW 8 108951357 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CAAACCCAGTAGCATGGAGC -3'
(R):5'- TGATGATCTGCGGGTACACG -3'

Sequencing Primer
(F):5'- ATGGAGCAGCCCACAGG -3'
(R):5'- ACCCCTGGGAGAGAGTTCAG -3'
Posted On2017-06-26