Incidental Mutation 'R6021:Rsf1'
ID478941
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Nameremodeling and spacing factor 1
Synonymsp325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6021 (G1)
Quality Score214.458
Status Not validated
Chromosome7
Chromosomal Location97579889-97692778 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to GACGGCGGCT at 97579909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000178078]
Predicted Effect unknown
Transcript: ENSMUST00000042399
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Ltbp3 A T 19: 5,753,680 T798S probably benign Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCGATCTAACTCAGTTCTCGAC -3'
(R):5'- AGAGCCCCAGGGTATCTATG -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- CCCAGGGTATCTATGGAGAGC -3'
Posted On2017-06-26