Incidental Mutation 'R6021:Ltbp3'
ID478974
Institutional Source Beutler Lab
Gene Symbol Ltbp3
Ensembl Gene ENSMUSG00000024940
Gene Namelatent transforming growth factor beta binding protein 3
SynonymsLtbp2
MMRRC Submission 044194-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6021 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5740904-5758532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5753680 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 798 (T798S)
Ref Sequence ENSEMBL: ENSMUSP00000080214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably benign
Transcript: ENSMUST00000025890
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081496
AA Change: T798S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: T798S

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,061,082 T338A probably damaging Het
4933427I04Rik A G 4: 123,860,716 D141G possibly damaging Het
A1bg T C 15: 60,919,864 E241G possibly damaging Het
Abca13 G A 11: 9,290,465 W776* probably null Het
Akr1b10 T A 6: 34,392,374 probably null Het
Atf7 T C 15: 102,557,473 D84G probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Azi2 T A 9: 118,047,419 M1K probably null Het
Boc T A 16: 44,488,654 M832L probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacna1s T C 1: 136,106,487 L1050P probably benign Het
Celsr2 G T 3: 108,401,245 P1789T probably benign Het
Crebbp G A 16: 4,085,418 R1986C probably damaging Het
Crtam T A 9: 40,990,181 I150F probably damaging Het
Crybg1 G T 10: 43,997,538 S1191R probably damaging Het
D630045J12Rik T C 6: 38,190,617 T1017A probably benign Het
Dnah10 A G 5: 124,736,984 E396G probably damaging Het
Enpp5 A T 17: 44,085,319 Y374F probably benign Het
Fzd4 G A 7: 89,407,734 A330T probably benign Het
Gabra5 A G 7: 57,507,992 S25P probably benign Het
Ggps1 T C 13: 14,054,004 Y198C probably damaging Het
Gm13101 A T 4: 143,965,766 C222S probably benign Het
Gm13762 G T 2: 88,973,032 Y286* probably null Het
Gm3173 A C 14: 4,514,873 D39A probably damaging Het
Gm4869 A T 5: 140,469,679 M347L probably damaging Het
Grm2 T C 9: 106,650,800 D295G probably damaging Het
H2-Bl T G 17: 36,081,274 E182A probably damaging Het
Igfbp5 A G 1: 72,863,204 M208T possibly damaging Het
Ildr2 T A 1: 166,303,604 M343K possibly damaging Het
Loxhd1 A T 18: 77,412,250 D120V probably damaging Het
Lrp1 T C 10: 127,578,014 D1175G probably damaging Het
Lrp1b C A 2: 41,344,427 D1171Y probably benign Het
Lrrc9 A T 12: 72,469,231 I563F probably damaging Het
Msantd4 T A 9: 4,384,063 V128E probably benign Het
Mtf2 A G 5: 108,081,137 I69V possibly damaging Het
Myh10 T A 11: 68,808,862 S1712T possibly damaging Het
Mylk3 A G 8: 85,364,813 V121A possibly damaging Het
Ndufaf4 A G 4: 24,901,760 N100D probably benign Het
Notch2 T C 3: 98,121,972 F1017S probably damaging Het
Olfr1197 G T 2: 88,728,950 Y216* probably null Het
Olfr1253 A C 2: 89,752,121 S236A probably benign Het
P2ry2 T C 7: 100,998,400 T233A probably benign Het
Paip1 T "TTA,TT" 13: 119,457,135 probably null Het
Pak1 T C 7: 97,854,463 S2P probably damaging Het
Pde8b A T 13: 95,026,162 D817E possibly damaging Het
Pfdn2 C A 1: 171,345,770 probably benign Het
Raver1 A G 9: 21,076,622 L606P probably damaging Het
Robo3 C T 9: 37,422,533 W668* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rxfp2 A G 5: 150,063,737 N337S possibly damaging Het
Samhd1 T C 2: 157,120,554 probably null Het
Sardh A G 2: 27,189,643 V879A probably benign Het
Slc4a4 A T 5: 89,040,402 probably benign Het
Slc6a11 T C 6: 114,230,051 L332P probably damaging Het
Tas2r135 T C 6: 42,406,387 Y287H probably damaging Het
Tlr4 T A 4: 66,840,866 I632N probably damaging Het
Tmem145 C T 7: 25,308,845 probably null Het
Trmt61a C A 12: 111,680,977 F169L probably damaging Het
Trp53tg5 T A 2: 164,471,471 I95L probably benign Het
Vmn1r85 T C 7: 13,084,689 E176G probably benign Het
Vmn2r75 T C 7: 86,171,612 D38G probably benign Het
Vmn2r99 A G 17: 19,377,948 Y78C probably damaging Het
Wrb T C 16: 96,145,678 probably benign Het
Zfp964 G T 8: 69,663,092 S114I unknown Het
Other mutations in Ltbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Ltbp3 APN 19 5756016 missense probably damaging 0.99
IGL00978:Ltbp3 APN 19 5754019 missense probably benign 0.26
IGL01517:Ltbp3 APN 19 5757732 missense possibly damaging 0.57
IGL01529:Ltbp3 APN 19 5747839 missense probably benign 0.06
IGL03119:Ltbp3 APN 19 5757443 missense probably damaging 0.98
csp UTSW 19 5747688 missense probably damaging 1.00
lilia UTSW 19 5747857 critical splice donor site probably null
rapunzel UTSW 19 5753942 nonsense probably null
PIT4305001:Ltbp3 UTSW 19 5752067 missense probably damaging 0.99
PIT4453001:Ltbp3 UTSW 19 5757794 missense probably damaging 0.97
PIT4480001:Ltbp3 UTSW 19 5751226 missense possibly damaging 0.73
R0211:Ltbp3 UTSW 19 5752143 critical splice donor site probably null
R0718:Ltbp3 UTSW 19 5746748 splice site probably benign
R1103:Ltbp3 UTSW 19 5747411 critical splice acceptor site probably null
R1103:Ltbp3 UTSW 19 5747412 critical splice acceptor site probably null
R1299:Ltbp3 UTSW 19 5745428 splice site probably benign
R1510:Ltbp3 UTSW 19 5748887 missense probably benign 0.02
R1616:Ltbp3 UTSW 19 5746967 missense probably damaging 1.00
R1682:Ltbp3 UTSW 19 5751754 missense probably benign 0.02
R1752:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R1806:Ltbp3 UTSW 19 5753942 nonsense probably null
R1866:Ltbp3 UTSW 19 5747849 missense probably benign 0.43
R1981:Ltbp3 UTSW 19 5758079 missense probably benign 0.15
R2211:Ltbp3 UTSW 19 5753962 missense possibly damaging 0.79
R2239:Ltbp3 UTSW 19 5751523 nonsense probably null
R2261:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2263:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2380:Ltbp3 UTSW 19 5751523 nonsense probably null
R2412:Ltbp3 UTSW 19 5746645 missense probably benign 0.08
R2446:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R2449:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3056:Ltbp3 UTSW 19 5751406 missense probably benign 0.11
R3080:Ltbp3 UTSW 19 5756888 frame shift probably null
R3863:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3864:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3951:Ltbp3 UTSW 19 5756001 missense probably damaging 1.00
R3961:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3962:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3963:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R3972:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4028:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4031:Ltbp3 UTSW 19 5754022 missense probably benign 0.02
R4041:Ltbp3 UTSW 19 5751871 missense possibly damaging 0.95
R4060:Ltbp3 UTSW 19 5742320 missense probably benign 0.41
R4296:Ltbp3 UTSW 19 5756582 critical splice acceptor site probably null
R4525:Ltbp3 UTSW 19 5746359 missense probably benign 0.09
R4660:Ltbp3 UTSW 19 5748786 intron probably null
R4794:Ltbp3 UTSW 19 5756679 missense probably damaging 1.00
R4980:Ltbp3 UTSW 19 5753927 critical splice acceptor site probably null
R5071:Ltbp3 UTSW 19 5756823 missense probably damaging 1.00
R5702:Ltbp3 UTSW 19 5747821 missense probably benign
R5771:Ltbp3 UTSW 19 5747544 missense probably damaging 1.00
R6053:Ltbp3 UTSW 19 5752094 missense probably damaging 0.98
R6321:Ltbp3 UTSW 19 5745657 missense probably benign 0.09
R6339:Ltbp3 UTSW 19 5747477 missense probably damaging 1.00
R6371:Ltbp3 UTSW 19 5745772 splice site probably null
R6709:Ltbp3 UTSW 19 5747857 critical splice donor site probably null
X0066:Ltbp3 UTSW 19 5751277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGTATCGCCACGGACTC -3'
(R):5'- CACAACTGGGATCTGGATGG -3'

Sequencing Primer
(F):5'- ACGGACTCTTGGGAACACTTGAC -3'
(R):5'- ATCTGGATGGCCTTGGAGC -3'
Posted On2017-06-26