Incidental Mutation 'R6022:Atxn2l'
ID478995
Institutional Source Beutler Lab
Gene Symbol Atxn2l
Ensembl Gene ENSMUSG00000032637
Gene Nameataxin 2-like
SynonymsA2lp, A2D, A2RP, A2LG
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R6022 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126491708-126503437 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 126496435 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000179818] [ENSMUST00000206265] [ENSMUST00000206577]
Predicted Effect probably null
Transcript: ENSMUST00000040202
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166682
SMART Domains Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 1 69 1.6e-21 PFAM
LsmAD 142 211 1.95e-28 SMART
low complexity region 237 262 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
Pfam:PAM2 537 553 4.3e-8 PFAM
low complexity region 561 577 N/A INTRINSIC
low complexity region 644 667 N/A INTRINSIC
low complexity region 800 827 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167759
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179818
SMART Domains Protein: ENSMUSP00000137108
Gene: ENSMUSG00000032637

DomainStartEndE-ValueType
Pfam:SM-ATX 62 132 4.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206265
Predicted Effect probably null
Transcript: ENSMUST00000206577
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Adam9 T C 8: 25,003,305 T96A possibly damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Jmy G T 13: 93,453,578 probably null Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Phc3 A G 3: 30,930,025 S647P probably damaging Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tecpr1 A T 5: 144,199,191 W961R possibly damaging Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in Atxn2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Atxn2l APN 7 126498288 missense possibly damaging 0.94
IGL00507:Atxn2l APN 7 126496584 missense possibly damaging 0.51
IGL00846:Atxn2l APN 7 126499178 missense probably damaging 1.00
IGL01813:Atxn2l APN 7 126500253 missense probably damaging 1.00
R0005:Atxn2l UTSW 7 126498274 missense probably damaging 1.00
R0267:Atxn2l UTSW 7 126493207 missense probably damaging 1.00
R0608:Atxn2l UTSW 7 126501416 splice site probably null
R0749:Atxn2l UTSW 7 126500837 missense possibly damaging 0.50
R0831:Atxn2l UTSW 7 126499160 missense probably damaging 1.00
R0881:Atxn2l UTSW 7 126496596 missense probably damaging 1.00
R1022:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1024:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1081:Atxn2l UTSW 7 126494212 missense probably damaging 1.00
R1132:Atxn2l UTSW 7 126494248 small deletion probably benign
R1489:Atxn2l UTSW 7 126496467 missense probably damaging 1.00
R1919:Atxn2l UTSW 7 126493168 missense probably damaging 0.99
R2062:Atxn2l UTSW 7 126495866 missense probably damaging 1.00
R2170:Atxn2l UTSW 7 126503239 start gained probably benign
R3719:Atxn2l UTSW 7 126498130 missense probably damaging 1.00
R3861:Atxn2l UTSW 7 126501951 critical splice donor site probably null
R5061:Atxn2l UTSW 7 126500203 missense probably damaging 1.00
R6075:Atxn2l UTSW 7 126492517 missense possibly damaging 0.70
R6131:Atxn2l UTSW 7 126503165 unclassified probably benign
R6460:Atxn2l UTSW 7 126494248 small deletion probably benign
R6552:Atxn2l UTSW 7 126493821 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACAGAGTAAAGTTGCCCTCAC -3'
(R):5'- GCCAGCAATAACTATCGTGTAGC -3'

Sequencing Primer
(F):5'- AGAGTAAAGTTGCCCTCACCTTTC -3'
(R):5'- AGCAATAACTATCGTGTAGCTCTCC -3'
Posted On2017-06-26