Incidental Mutation 'R6022:Adam9'
ID478997
Institutional Source Beutler Lab
Gene Symbol Adam9
Ensembl Gene ENSMUSG00000031555
Gene Namea disintegrin and metallopeptidase domain 9 (meltrin gamma)
SynonymsMDC9, MDC9, Mltng, Mltng
MMRRC Submission 043256-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6022 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24949611-25016927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25003305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 96 (T96A)
Ref Sequence ENSEMBL: ENSMUSP00000146545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000207132] [ENSMUST00000208247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084032
AA Change: T96A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: T96A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 163 8.5e-36 PFAM
Pfam:Reprolysin_5 210 386 5.5e-20 PFAM
Pfam:Reprolysin_4 210 402 1.4e-11 PFAM
Pfam:Reprolysin 212 406 1e-67 PFAM
Pfam:Reprolysin_2 232 396 1.1e-12 PFAM
Pfam:Reprolysin_3 236 358 8.1e-19 PFAM
DISIN 423 499 8.7e-44 SMART
ACR 500 637 9.7e-75 SMART
EGF 643 674 9.9e-2 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 787 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084035
AA Change: T96A

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: T96A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 163 8.1e-31 PFAM
Pfam:Reprolysin_5 210 386 5.8e-22 PFAM
Pfam:Reprolysin_4 210 402 1.6e-13 PFAM
Pfam:Reprolysin 212 406 1.9e-73 PFAM
Pfam:Reprolysin_2 232 396 9.4e-15 PFAM
Pfam:Reprolysin_3 236 358 3.4e-19 PFAM
DISIN 423 499 1.71e-41 SMART
ACR 500 637 2.86e-72 SMART
EGF 643 674 2.03e1 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 794 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 831 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207132
Predicted Effect possibly damaging
Transcript: ENSMUST00000208247
AA Change: T96A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T G 11: 9,290,759 F874C probably damaging Het
Arhgef26 C T 3: 62,428,939 T633M probably damaging Het
Atxn2l A G 7: 126,496,435 probably null Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Caskin1 T A 17: 24,496,735 F158I probably benign Het
Ces1g T A 8: 93,328,457 N204I probably damaging Het
Chd1 A G 17: 17,377,773 I41V probably benign Het
Crybg2 A T 4: 134,074,273 K915* probably null Het
Dock4 T C 12: 40,748,110 V911A probably benign Het
Dok5 A G 2: 170,879,222 Y302C probably damaging Het
Dpysl4 A T 7: 139,086,084 probably benign Het
Dsc3 A C 18: 19,966,338 V707G probably damaging Het
Endog A G 2: 30,172,909 Y187C possibly damaging Het
Fcrl5 A G 3: 87,455,763 T526A probably benign Het
Gcat T C 15: 79,042,278 V116A probably damaging Het
Gm10471 T G 5: 26,084,679 E250A probably benign Het
Herc1 A G 9: 66,483,685 D3975G probably damaging Het
Jmy G T 13: 93,453,578 probably null Het
Kif1b T C 4: 149,198,532 I1273V probably benign Het
Lrriq1 G T 10: 103,215,534 N452K possibly damaging Het
Lrrn3 T C 12: 41,453,430 E296G probably damaging Het
Marco G A 1: 120,488,565 L208F probably benign Het
Mme T A 3: 63,364,797 W606R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Phc3 A G 3: 30,930,025 S647P probably damaging Het
Prx A G 7: 27,517,573 K500E probably damaging Het
Ptpn22 T A 3: 103,886,105 V524E probably benign Het
Ptprj A T 2: 90,471,323 I155K probably benign Het
Rad51ap2 A G 12: 11,458,522 E815G probably damaging Het
Rnf150 T C 8: 83,042,729 V381A probably benign Het
Rnf213 A G 11: 119,486,010 K5103R probably benign Het
Tecpr1 A T 5: 144,199,191 W961R possibly damaging Het
Tnn A T 1: 160,110,358 D932E probably benign Het
Tram2 G A 1: 21,079,137 probably benign Het
Trbv26 T A 6: 41,227,575 probably benign Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Ttk T C 9: 83,839,322 Y87H probably damaging Het
Uri1 A T 7: 37,961,477 probably benign Het
Vmn1r173 A G 7: 23,702,835 D165G probably benign Het
Xpc A G 6: 91,499,636 S494P probably damaging Het
Zfp438 T A 18: 5,213,419 N513I probably damaging Het
Other mutations in Adam9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Adam9 APN 8 24967196 missense probably benign 0.03
IGL01786:Adam9 APN 8 24996839 missense probably damaging 1.00
IGL02095:Adam9 APN 8 24996729 missense probably benign 0.00
IGL02322:Adam9 APN 8 24955974 missense probably damaging 1.00
IGL02555:Adam9 APN 8 24966736 missense probably damaging 1.00
IGL02869:Adam9 APN 8 24970618 missense probably damaging 1.00
R0126:Adam9 UTSW 8 24970737 missense probably damaging 1.00
R0448:Adam9 UTSW 8 24964910 missense probably damaging 1.00
R0552:Adam9 UTSW 8 24963010 missense probably benign 0.00
R0730:Adam9 UTSW 8 24996758 missense probably benign 0.02
R1455:Adam9 UTSW 8 24993109 missense probably benign 0.00
R1974:Adam9 UTSW 8 24992224 missense probably damaging 1.00
R2043:Adam9 UTSW 8 24996653 critical splice donor site probably null
R2054:Adam9 UTSW 8 24991294 missense probably damaging 1.00
R2091:Adam9 UTSW 8 24995184 splice site probably benign
R2111:Adam9 UTSW 8 24982126 splice site probably benign
R4261:Adam9 UTSW 8 24964907 nonsense probably null
R4852:Adam9 UTSW 8 25003301 missense probably damaging 1.00
R5165:Adam9 UTSW 8 24967174 missense possibly damaging 0.88
R6101:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6105:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6415:Adam9 UTSW 8 24978482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAGGCATCCTGTAAGG -3'
(R):5'- TTTACATCAGTCGGCTGCGG -3'

Sequencing Primer
(F):5'- CCTGTAAGGATATGGAAGGTGTCC -3'
(R):5'- CTTATGAGCTGTGCCCTA -3'
Posted On2017-06-26