Incidental Mutation 'R6023:Psg29'
ID479034
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
MMRRC Submission 044195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 17210512 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 316 (V316L)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075934
AA Change: V316L

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: V316L

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Atrn T C 2: 131,020,980 F1327L probably benign Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kel C A 6: 41,697,475 E340D probably benign Het
Kif11 A G 19: 37,390,710 E283G probably damaging Het
Klk4 T G 7: 43,884,058 F114V probably benign Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr1477 A G 19: 13,502,703 D120G probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3054:Psg29 UTSW 7 17208802 missense probably benign 0.29
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCGCTTTTCAGTGCTGTAAC -3'
(R):5'- GGGTAAGTCACACATAGCAACC -3'

Sequencing Primer
(F):5'- TCAGTGCTGTAACCCTAGCAC -3'
(R):5'- CAGAGTCCATTGAGAGTCACTTAAC -3'
Posted On2017-06-26