Incidental Mutation 'R6023:Klk4'
ID479035
Institutional Source Beutler Lab
Gene Symbol Klk4
Ensembl Gene ENSMUSG00000006948
Gene Namekallikrein related-peptidase 4 (prostase, enamel matrix, prostate)
SynonymsESMP1, Prss17, KLK-L1
MMRRC Submission 044195-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6023 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43881160-43885804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43884058 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 114 (F114V)
Ref Sequence ENSEMBL: ENSMUSP00000007161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007161]
Predicted Effect probably benign
Transcript: ENSMUST00000007161
AA Change: F114V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000007161
Gene: ENSMUSG00000006948
AA Change: F114V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Tryp_SPc 31 248 2.42e-82 SMART
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Several transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced enamel strength that leads to enamel fracturing, delayed postnatal growth, and decreased survival to maturity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,108,419 N1302S possibly damaging Het
Aff3 A T 1: 38,218,370 S424T probably damaging Het
Ap2b1 C T 11: 83,335,398 T207M probably damaging Het
Appl2 T C 10: 83,648,529 Q18R probably null Het
Atrn T C 2: 131,020,980 F1327L probably benign Het
Birc6 A T 17: 74,654,377 I47F probably benign Het
Cdh23 A T 10: 60,465,542 I451N probably damaging Het
Clec3a A G 8: 114,418,143 T20A possibly damaging Het
Cpz T A 5: 35,512,578 I252F probably benign Het
Ctc1 A G 11: 69,022,607 D143G probably benign Het
Dhrs1 A T 14: 55,743,670 Y94* probably null Het
Dnajc25 A G 4: 59,013,752 K157E possibly damaging Het
Dpp6 T C 5: 27,723,547 I789T probably damaging Het
Duox1 T G 2: 122,337,684 F1097V probably benign Het
Ercc8 A G 13: 108,178,577 T242A probably damaging Het
Evc2 T A 5: 37,348,616 M93K probably benign Het
Glra1 A T 11: 55,533,853 V94E probably damaging Het
Got1l1 A T 8: 27,199,904 Y151* probably null Het
Hcrtr2 T A 9: 76,230,604 I410F probably benign Het
Ighv1-72 T A 12: 115,757,912 probably benign Het
Kel C A 6: 41,697,475 E340D probably benign Het
Kif11 A G 19: 37,390,710 E283G probably damaging Het
Krt7 T C 15: 101,412,397 probably benign Het
Lrrc74a A G 12: 86,758,606 I401V probably damaging Het
Luzp2 T C 7: 55,058,067 S68P possibly damaging Het
Naip1 T C 13: 100,426,186 T824A probably benign Het
Nav3 T C 10: 109,823,515 Q747R possibly damaging Het
Olfr1212 A G 2: 88,958,715 D83G possibly damaging Het
Olfr1342 T A 4: 118,690,074 Y126F probably damaging Het
Olfr1477 A G 19: 13,502,703 D120G probably damaging Het
Olfr339 A G 2: 36,421,511 T38A probably damaging Het
Olfr566 T C 7: 102,856,962 I107V possibly damaging Het
Olfr649 T C 7: 104,189,673 H178R probably damaging Het
Olfr837 A C 9: 19,137,725 H244P probably damaging Het
Pcdhb11 T C 18: 37,422,925 I436T possibly damaging Het
Pfdn2 T C 1: 171,356,751 Y65H probably damaging Het
Polr2h T C 16: 20,719,026 Y58H probably benign Het
Prrt4 G A 6: 29,176,453 P291L probably benign Het
Psg29 G T 7: 17,210,512 V316L possibly damaging Het
Rnf112 T A 11: 61,449,729 E525V probably damaging Het
Sgms1 T C 19: 32,124,373 K411R probably benign Het
Sh3tc1 T A 5: 35,706,951 K631* probably null Het
Syne1 T C 10: 5,443,223 M48V probably benign Het
Thrb C T 14: 18,011,209 T226I probably damaging Het
Trim67 A T 8: 124,815,104 D347V probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn G T 2: 76,735,400 L19876I probably damaging Het
Vars C T 17: 35,001,609 R56C probably damaging Het
Vmn1r9 A G 6: 57,071,254 I105V probably benign Het
Vps8 C A 16: 21,461,238 T313K probably benign Het
Other mutations in Klk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Klk4 UTSW 7 43885361 missense probably damaging 1.00
R0385:Klk4 UTSW 7 43884008 missense probably benign 0.02
R1381:Klk4 UTSW 7 43885282 missense probably damaging 1.00
R4329:Klk4 UTSW 7 43884406 missense probably damaging 1.00
R4552:Klk4 UTSW 7 43884019 missense probably benign
R4600:Klk4 UTSW 7 43885338 missense probably damaging 1.00
R7164:Klk4 UTSW 7 43881698 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGCAGGAGATCGCTGTTGC -3'
(R):5'- GAGGGTCAGTCCATTTTGGC -3'

Sequencing Primer
(F):5'- CAGGAGATCGCTGTTGCTTTAG -3'
(R):5'- TGTGGGGAACTTCTCAGAGAG -3'
Posted On2017-06-26