Incidental Mutation 'R6023:Thrb'
ID 479056
Institutional Source Beutler Lab
Gene Symbol Thrb
Ensembl Gene ENSMUSG00000021779
Gene Name thyroid hormone receptor beta
Synonyms T3R[b], TR beta, c-erbAbeta, Nr1a2, Thrb1, Thrb2, T3Rbeta
MMRRC Submission 044195-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.623) question?
Stock # R6023 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 4431611-4809435 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18011209 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 226 (T226I)
Ref Sequence ENSEMBL: ENSMUSP00000089053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022303] [ENSMUST00000022304] [ENSMUST00000091471] [ENSMUST00000224934]
AlphaFold P37242
Predicted Effect probably damaging
Transcript: ENSMUST00000022303
AA Change: T226I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022303
Gene: ENSMUSG00000021779
AA Change: T226I

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022304
AA Change: T240I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022304
Gene: ENSMUSG00000021779
AA Change: T240I

DomainStartEndE-ValueType
ZnF_C4 118 191 2.88e-36 SMART
low complexity region 202 217 N/A INTRINSIC
HOLI 288 446 9.29e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091471
AA Change: T226I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000089053
Gene: ENSMUSG00000021779
AA Change: T226I

DomainStartEndE-ValueType
ZnF_C4 104 177 2.88e-36 SMART
low complexity region 188 203 N/A INTRINSIC
HOLI 274 432 9.29e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224512
Predicted Effect probably damaging
Transcript: ENSMUST00000224934
AA Change: T195I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225876
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Mutations in this gene are known to be a cause of generalized thyroid hormone resistance (GTHR), a syndrome characterized by goiter and high levels of circulating thyroid hormone (T3-T4), with normal or slightly elevated thyroid stimulating hormone (TSH). Several alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated T3, T4, and TSH serum levels, abnormal ear morphology, deafness, and abnormal thyroid morphology. Mice homozygous for allele with point mutations exhibit disruption in thyroid hormone sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 45,757,843 (GRCm39) N1302S possibly damaging Het
Aff3 A T 1: 38,257,451 (GRCm39) S424T probably damaging Het
Ap2b1 C T 11: 83,226,224 (GRCm39) T207M probably damaging Het
Appl2 T C 10: 83,484,393 (GRCm39) Q18R probably null Het
Atrn T C 2: 130,862,900 (GRCm39) F1327L probably benign Het
Birc6 A T 17: 74,961,372 (GRCm39) I47F probably benign Het
Cdh23 A T 10: 60,301,321 (GRCm39) I451N probably damaging Het
Clec3a A G 8: 115,144,883 (GRCm39) T20A possibly damaging Het
Cpz T A 5: 35,669,922 (GRCm39) I252F probably benign Het
Ctc1 A G 11: 68,913,433 (GRCm39) D143G probably benign Het
Dhrs1 A T 14: 55,981,127 (GRCm39) Y94* probably null Het
Dnajc25 A G 4: 59,013,752 (GRCm39) K157E possibly damaging Het
Dpp6 T C 5: 27,928,545 (GRCm39) I789T probably damaging Het
Duox1 T G 2: 122,168,165 (GRCm39) F1097V probably benign Het
Ercc8 A G 13: 108,315,111 (GRCm39) T242A probably damaging Het
Evc2 T A 5: 37,505,960 (GRCm39) M93K probably benign Het
Glra1 A T 11: 55,424,679 (GRCm39) V94E probably damaging Het
Got1l1 A T 8: 27,689,932 (GRCm39) Y151* probably null Het
Hcrtr2 T A 9: 76,137,886 (GRCm39) I410F probably benign Het
Ighv1-72 T A 12: 115,721,532 (GRCm39) probably benign Het
Kel C A 6: 41,674,409 (GRCm39) E340D probably benign Het
Kif11 A G 19: 37,379,158 (GRCm39) E283G probably damaging Het
Klk4 T G 7: 43,533,482 (GRCm39) F114V probably benign Het
Krt7 T C 15: 101,310,278 (GRCm39) probably benign Het
Lrrc74a A G 12: 86,805,380 (GRCm39) I401V probably damaging Het
Luzp2 T C 7: 54,707,815 (GRCm39) S68P possibly damaging Het
Naip1 T C 13: 100,562,694 (GRCm39) T824A probably benign Het
Nav3 T C 10: 109,659,376 (GRCm39) Q747R possibly damaging Het
Or13p4 T A 4: 118,547,271 (GRCm39) Y126F probably damaging Het
Or1j11 A G 2: 36,311,523 (GRCm39) T38A probably damaging Het
Or4c107 A G 2: 88,789,059 (GRCm39) D83G possibly damaging Het
Or51f1 T C 7: 102,506,169 (GRCm39) I107V possibly damaging Het
Or52h2 T C 7: 103,838,880 (GRCm39) H178R probably damaging Het
Or5b120 A G 19: 13,480,067 (GRCm39) D120G probably damaging Het
Or7g22 A C 9: 19,049,021 (GRCm39) H244P probably damaging Het
Pcdhb11 T C 18: 37,555,978 (GRCm39) I436T possibly damaging Het
Pfdn2 T C 1: 171,184,319 (GRCm39) Y65H probably damaging Het
Polr2h T C 16: 20,537,776 (GRCm39) Y58H probably benign Het
Prrt4 G A 6: 29,176,452 (GRCm39) P291L probably benign Het
Psg29 G T 7: 16,944,437 (GRCm39) V316L possibly damaging Het
Rnf112 T A 11: 61,340,555 (GRCm39) E525V probably damaging Het
Sgms1 T C 19: 32,101,773 (GRCm39) K411R probably benign Het
Sh3tc1 T A 5: 35,864,295 (GRCm39) K631* probably null Het
Syne1 T C 10: 5,393,223 (GRCm39) M48V probably benign Het
Trim67 A T 8: 125,541,843 (GRCm39) D347V probably damaging Het
Try4 T C 6: 41,280,355 (GRCm39) S60P probably damaging Het
Ttn G T 2: 76,565,744 (GRCm39) L19876I probably damaging Het
Vars1 C T 17: 35,220,585 (GRCm39) R56C probably damaging Het
Vmn1r9 A G 6: 57,048,239 (GRCm39) I105V probably benign Het
Vps8 C A 16: 21,279,988 (GRCm39) T313K probably benign Het
Other mutations in Thrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Thrb APN 14 18,011,056 (GRCm38) splice site probably benign
IGL02488:Thrb APN 14 18,033,455 (GRCm38) missense probably damaging 0.98
IGL02598:Thrb APN 14 18,008,606 (GRCm38) missense possibly damaging 0.95
IGL02707:Thrb APN 14 18,026,721 (GRCm38) missense probably benign 0.42
harry UTSW 14 18,011,145 (GRCm38) nonsense probably null
R0479:Thrb UTSW 14 18,033,643 (GRCm38) missense probably damaging 0.99
R0988:Thrb UTSW 14 17,981,837 (GRCm38) intron probably benign
R1257:Thrb UTSW 14 18,008,642 (GRCm38) missense probably damaging 1.00
R1522:Thrb UTSW 14 18,002,597 (GRCm38) missense probably damaging 1.00
R1927:Thrb UTSW 14 18,008,674 (GRCm38) missense probably damaging 1.00
R2100:Thrb UTSW 14 18,030,393 (GRCm38) missense possibly damaging 0.73
R2134:Thrb UTSW 14 18,033,487 (GRCm38) missense probably benign 0.22
R3551:Thrb UTSW 14 17,963,214 (GRCm38) missense probably damaging 0.99
R3888:Thrb UTSW 14 18,033,551 (GRCm38) missense probably damaging 1.00
R3975:Thrb UTSW 14 18,033,456 (GRCm38) missense probably damaging 1.00
R4294:Thrb UTSW 14 18,011,145 (GRCm38) nonsense probably null
R4371:Thrb UTSW 14 18,030,275 (GRCm38) missense probably damaging 1.00
R4454:Thrb UTSW 14 18,011,187 (GRCm38) missense probably damaging 0.97
R4457:Thrb UTSW 14 18,011,187 (GRCm38) missense probably damaging 0.97
R4486:Thrb UTSW 14 17,925,640 (GRCm38) start codon destroyed probably null 0.72
R4961:Thrb UTSW 14 18,011,076 (GRCm38) missense probably benign 0.39
R5184:Thrb UTSW 14 18,011,181 (GRCm38) nonsense probably null
R5609:Thrb UTSW 14 18,033,526 (GRCm38) missense probably benign 0.22
R6891:Thrb UTSW 14 17,981,899 (GRCm38) missense probably benign
R7288:Thrb UTSW 14 18,030,186 (GRCm38) missense probably damaging 1.00
R7294:Thrb UTSW 14 17,826,963 (GRCm38) start gained probably benign
R7780:Thrb UTSW 14 18,008,608 (GRCm38) missense possibly damaging 0.73
R8098:Thrb UTSW 14 18,008,645 (GRCm38) missense probably damaging 1.00
R8739:Thrb UTSW 14 17,963,082 (GRCm38) missense probably benign 0.04
R8788:Thrb UTSW 14 18,002,558 (GRCm38) missense probably damaging 1.00
R8978:Thrb UTSW 14 17,981,886 (GRCm38) missense possibly damaging 0.84
R9314:Thrb UTSW 14 17,963,208 (GRCm38) missense probably benign
Z1177:Thrb UTSW 14 18,033,433 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGCAATGGGTCCTCTCAC -3'
(R):5'- TAGCCTCTGTAACCTCATTGGC -3'

Sequencing Primer
(F):5'- ACCTTTCTACTTTGCAGTGGTG -3'
(R):5'- ATTGCAGTTCCAGCCCTCTGAG -3'
Posted On 2017-06-26