Incidental Mutation 'R0512:Sorl1'
ID47912
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 038706-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0512 (G1)
Quality Score102
Status Validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42067832 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 457 (A457S)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably benign
Transcript: ENSMUST00000060989
AA Change: A457S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: A457S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 114,863,508 M22R probably benign Het
Abca8b C A 11: 109,950,650 M1039I probably benign Het
Actn2 A T 13: 12,277,415 I653N probably damaging Het
Actr8 G T 14: 29,978,556 V31L probably benign Het
Adam30 T C 3: 98,162,125 C425R probably damaging Het
Armc1 A G 3: 19,149,495 V89A possibly damaging Het
Atr T C 9: 95,935,526 M2090T probably damaging Het
Braf T A 6: 39,664,989 probably benign Het
Cant1 A T 11: 118,411,265 N75K probably benign Het
Chd7 C T 4: 8,805,139 probably benign Het
Clec16a A G 16: 10,614,580 Y488C probably damaging Het
Col6a3 A T 1: 90,821,798 probably benign Het
Col9a2 T A 4: 121,054,307 M615K probably benign Het
D3Ertd254e T C 3: 36,166,113 C762R probably damaging Het
Dedd G A 1: 171,340,930 R228H probably damaging Het
Dhtkd1 C T 2: 5,904,091 D731N probably damaging Het
Ercc2 A G 7: 19,393,887 T651A probably damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fam193a T C 5: 34,426,391 S19P probably damaging Het
Fam208a T C 14: 27,446,406 F302L probably damaging Het
Fam43a T C 16: 30,601,735 V379A possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fat1 C A 8: 44,951,332 Y373* probably null Het
Fbxl15 A C 19: 46,329,422 D181A probably damaging Het
Flt3 A T 5: 147,341,270 C831* probably null Het
Foxj3 T A 4: 119,585,836 probably benign Het
Glul T C 1: 153,905,386 probably benign Het
Gm16380 A T 9: 53,884,245 noncoding transcript Het
Gm7964 A T 7: 83,755,950 noncoding transcript Het
Hipk1 A G 3: 103,760,574 F559S possibly damaging Het
Hnf4g A T 3: 3,651,622 I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icosl A G 10: 78,071,966 N120S possibly damaging Het
Ift172 A G 5: 31,285,477 V155A possibly damaging Het
Kdm4c A G 4: 74,333,794 E426G probably benign Het
Kif23 A G 9: 61,918,975 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,779,134 C1456Y possibly damaging Het
Lamc3 T A 2: 31,937,968 L1378Q probably damaging Het
Larp1b T A 3: 40,970,034 L121M probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lepr A C 4: 101,814,704 D975A possibly damaging Het
Magi1 A G 6: 93,694,064 V1068A probably damaging Het
Malt1 T A 18: 65,458,200 N358K probably damaging Het
Mfap4 T A 11: 61,487,945 W240R probably damaging Het
Mis18a A G 16: 90,726,356 V84A possibly damaging Het
Mns1 A G 9: 72,449,471 E308G possibly damaging Het
Mpp2 C A 11: 102,062,290 L258F possibly damaging Het
Myh2 A G 11: 67,188,678 E987G probably damaging Het
Myof A G 19: 37,954,524 V702A possibly damaging Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Nrxn2 A G 19: 6,517,198 T1360A probably damaging Het
Obox6 A G 7: 15,833,949 I191T probably benign Het
Pacs2 G T 12: 113,050,927 R236L probably damaging Het
Pcdhb2 T G 18: 37,295,979 V335G probably damaging Het
Phyhipl T C 10: 70,568,918 I140M probably damaging Het
Pkhd1 T C 1: 20,310,514 probably benign Het
Ppp1r3b T G 8: 35,384,417 C137G probably damaging Het
Prdm13 T A 4: 21,678,490 I667F probably damaging Het
Prex2 A G 1: 11,199,933 M1281V probably benign Het
Rab40b A G 11: 121,359,586 F81L probably damaging Het
Rb1cc1 T C 1: 6,248,543 S729P probably damaging Het
Rcl1 A G 19: 29,128,097 D228G probably damaging Het
Rhbdf1 A T 11: 32,210,875 C19* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf150 G A 8: 82,864,178 V57M probably benign Het
Rp9 A G 9: 22,458,719 F51L probably benign Het
Sav1 A T 12: 69,969,201 Y274* probably null Het
Scn4a A T 11: 106,345,677 D252E probably damaging Het
Scn5a T C 9: 119,550,658 T187A probably damaging Het
Sigirr T A 7: 141,092,420 D229V probably benign Het
Slc39a13 T C 2: 91,065,686 S157G possibly damaging Het
Slc6a20a A G 9: 123,660,406 S191P probably damaging Het
Spag5 A G 11: 78,319,586 probably benign Het
Spon1 A G 7: 113,836,833 E119G possibly damaging Het
Spred2 T A 11: 20,008,485 probably benign Het
Sprr3 T G 3: 92,457,477 Q20P possibly damaging Het
Strn3 A T 12: 51,627,183 F464L possibly damaging Het
Sun1 A G 5: 139,234,847 probably benign Het
Sypl2 A G 3: 108,226,170 W28R possibly damaging Het
Syt5 A T 7: 4,542,814 V150D probably damaging Het
Thsd7a A G 6: 12,379,605 I940T possibly damaging Het
Tnrc6a T A 7: 123,186,728 probably benign Het
Trp53 T A 11: 69,588,683 L203Q probably damaging Het
Tubgcp4 T C 2: 121,175,419 V96A probably benign Het
Usp17la A G 7: 104,861,039 T284A possibly damaging Het
Usp34 T C 11: 23,451,997 M2409T probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r56 A G 7: 12,715,423 I296T probably benign Het
Vmn2r67 A G 7: 85,150,692 V446A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAGCTCACGAGTCAAACAAGCAG -3'
(R):5'- TGCCAAGTAAATGCCGATCCCG -3'

Sequencing Primer
(F):5'- TCAAACAAGCAGGGTCTGTATG -3'
(R):5'- CAAGGAGTCTATATTGCCACCC -3'
Posted On2013-06-12