Mutagenetix > Incidental Mutation

Incidental Mutation 'R6035:Ash1l'

479127

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor

MMRRC Submission

044207-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6035 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88857929-88986682 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88892326 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1402 (Y1402H)

Ref Sequence

ENSEMBL: ENSMUSP00000140251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090933
AA Change: Y1402H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: Y1402H

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186583
AA Change: Y1402H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: Y1402H

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 99.8%
3x: 98.9%
10x: 91.8%
20x: 70.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	G	T	6: 121,615,353 (GRCm39)	G76W	probably damaging	Het
Abca17	A	T	17: 24,500,219 (GRCm39)	F1324Y	possibly damaging	Het
Abca8b	A	T	11: 109,862,686 (GRCm39)		probably null	Het
Abcc12	A	G	8: 87,244,033 (GRCm39)	M1040T	probably damaging	Het
Abtb1	A	G	6: 88,818,788 (GRCm39)	F7L	probably damaging	Het
Adcy9	T	C	16: 4,122,377 (GRCm39)	T558A	probably benign	Het
Adgrb1	A	T	15: 74,412,292 (GRCm39)	T424S	possibly damaging	Het
Afg3l2	G	T	18: 67,554,329 (GRCm39)	L458M	probably damaging	Het
Ankrd31	C	A	13: 96,968,721 (GRCm39)	P786Q	probably benign	Het
Arhgap39	G	T	15: 76,621,424 (GRCm39)	Y392*	probably null	Het
Carmil2	G	T	8: 106,419,195 (GRCm39)	W749L	probably benign	Het
Ccar1	A	G	10: 62,587,564 (GRCm39)	Y867H	unknown	Het
Cdh13	A	G	8: 119,232,437 (GRCm39)	D47G	probably benign	Het
Chst9	T	A	18: 15,585,910 (GRCm39)	T218S	probably benign	Het
Clec2i	G	A	6: 128,870,587 (GRCm39)	V67I	probably benign	Het
Cox7a2	T	A	9: 79,667,028 (GRCm39)		probably benign	Het
Cplx3	A	G	9: 57,519,030 (GRCm39)		probably null	Het
Cpz	A	G	5: 35,674,929 (GRCm39)	C107R	probably damaging	Het
Dapk1	T	A	13: 60,909,013 (GRCm39)	C1209S	possibly damaging	Het
Ddx41	T	C	13: 55,681,781 (GRCm39)	M307V	probably benign	Het
Defa24	A	G	8: 22,224,565 (GRCm39)	I5V	probably benign	Het
Dgcr8	A	T	16: 18,076,178 (GRCm39)	N2K	probably damaging	Het
Ebf2	A	G	14: 67,476,423 (GRCm39)	D131G	probably damaging	Het
Fam149b	C	T	14: 20,427,985 (GRCm39)	R424C	probably damaging	Het
Fbln2	G	A	6: 91,240,335 (GRCm39)	V714M	probably damaging	Het
Fgf5	T	C	5: 98,423,385 (GRCm39)	Y257H	probably damaging	Het
Fmo3	A	C	1: 162,791,605 (GRCm39)	V224G	probably damaging	Het
Gigyf2	T	C	1: 87,338,450 (GRCm39)	I394T	possibly damaging	Het
Glmn	T	A	5: 107,741,746 (GRCm39)		probably null	Het
Greb1l	T	C	18: 10,501,025 (GRCm39)	I385T	possibly damaging	Het
Grhl1	C	A	12: 24,658,449 (GRCm39)	Q365K	probably benign	Het
Gsdme	G	A	6: 50,206,306 (GRCm39)	T179M	probably damaging	Het
Gtf2a1l	A	G	17: 89,018,962 (GRCm39)	T349A	probably benign	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,905,247 (GRCm39)		probably benign	Het
Il5ra	G	A	6: 106,718,226 (GRCm39)	T76I	probably damaging	Het
Itga8	T	C	2: 12,196,525 (GRCm39)	T631A	probably benign	Het
Kcnh6	G	A	11: 105,909,978 (GRCm39)		probably null	Het
Krt26	C	T	11: 99,224,415 (GRCm39)	E368K	probably benign	Het
Lhx9	T	C	1: 138,766,281 (GRCm39)	D169G	possibly damaging	Het
Lmod3	A	G	6: 97,224,234 (GRCm39)	L529P	probably damaging	Het
Mroh2a	G	A	1: 88,158,390 (GRCm39)	V146M	probably damaging	Het
Nup155	A	G	15: 8,173,577 (GRCm39)	T891A	probably benign	Het
Or11g24	A	G	14: 50,661,984 (GRCm39)	T3A	probably benign	Het
Or1e1	T	C	11: 73,244,582 (GRCm39)	M1T	probably null	Het
Or1j13	T	A	2: 36,369,996 (GRCm39)	I49F	probably damaging	Het
Or1p4-ps1	T	C	11: 74,208,285 (GRCm39)	*145R	probably null	Het
Or8b36	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 37,937,836 (GRCm39)		probably null	Het
Papln	G	C	12: 83,821,454 (GRCm39)	G262A	probably damaging	Het
Pdcd1lg2	G	A	19: 29,423,435 (GRCm39)	V160I	probably benign	Het
Pde8b	A	G	13: 95,164,105 (GRCm39)		probably benign	Het
Ppme1	G	A	7: 100,004,002 (GRCm39)	R68*	probably null	Het
Ptprn2	A	T	12: 117,219,215 (GRCm39)	N949Y	probably damaging	Het
Qser1	C	A	2: 104,617,468 (GRCm39)	D1115Y	probably damaging	Het
Rad54l	G	T	4: 115,954,666 (GRCm39)	D674E	probably damaging	Het
Ripk4	T	A	16: 97,545,387 (GRCm39)	D420V	probably damaging	Het
Ros1	G	T	10: 51,954,067 (GRCm39)	S1857R	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,229,111 (GRCm39)		probably benign	Het
Rsf1	A	G	7: 97,311,316 (GRCm39)	E682G	probably benign	Het
Samd4	G	A	14: 47,325,329 (GRCm39)	R515H	probably damaging	Het
Selp	T	A	1: 163,969,079 (GRCm39)	W560R	probably benign	Het
Shc3	A	T	13: 51,615,468 (GRCm39)	L163Q	probably damaging	Het
Shh	G	A	5: 28,666,397 (GRCm39)	A163V	probably damaging	Het
Slc17a8	T	C	10: 89,427,937 (GRCm39)	R113G	possibly damaging	Het
Slc5a6	C	A	5: 31,206,168 (GRCm39)		probably benign	Het
Smarcd2	A	G	11: 106,157,715 (GRCm39)		probably null	Het
Sytl3	A	G	17: 6,995,664 (GRCm39)	D148G	probably damaging	Het
Tnks	G	T	8: 35,385,615 (GRCm39)	H297Q	possibly damaging	Het
Trbv21	A	T	6: 41,179,568 (GRCm39)		probably benign	Het
Ube3c	T	C	5: 29,806,161 (GRCm39)	F268L	probably benign	Het
Ugt2b5	T	C	5: 87,287,541 (GRCm39)	I209V	probably benign	Het
Usp1	A	G	4: 98,818,082 (GRCm39)	N140S	probably damaging	Het
Vcam1	T	C	3: 115,919,606 (GRCm39)	Y226C	probably damaging	Het
Vmn1r129	T	A	7: 21,094,534 (GRCm39)	Q228L	probably damaging	Het
Vmn1r209	T	A	13: 22,990,202 (GRCm39)	N163Y	probably benign	Het
Vmn1r85	A	G	7: 12,818,854 (GRCm39)	S97P	probably damaging	Het
Vmn2r30	C	T	7: 7,337,350 (GRCm39)	M95I	probably benign	Het
Vmn2r74	G	A	7: 85,601,098 (GRCm39)	R847C	probably damaging	Het
Wdr70	G	A	15: 7,916,830 (GRCm39)	T529I	possibly damaging	Het
Zfp532	T	G	18: 65,757,005 (GRCm39)	S313A	possibly damaging	Het
Zhx3	A	T	2: 160,621,463 (GRCm39)	N901K	probably benign	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88,889,019 (GRCm39)	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	88,915,043 (GRCm39)	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	88,942,543 (GRCm39)	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	88,979,791 (GRCm39)	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88,891,942 (GRCm39)	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	88,971,209 (GRCm39)	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88,890,836 (GRCm39)	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	88,973,572 (GRCm39)	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88,892,813 (GRCm39)	nonsense	probably null
IGL02326:Ash1l	APN	3	88,873,364 (GRCm39)	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	88,979,855 (GRCm39)	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88,892,872 (GRCm39)	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	88,976,386 (GRCm39)	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	88,973,525 (GRCm39)	nonsense	probably null
IGL02727:Ash1l	APN	3	88,930,344 (GRCm39)	missense	probably benign
IGL02732:Ash1l	APN	3	88,873,535 (GRCm39)	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88,892,108 (GRCm39)	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88,891,488 (GRCm39)	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	88,942,575 (GRCm39)	splice site	probably benign
IGL03253:Ash1l	APN	3	88,891,981 (GRCm39)	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	88,930,390 (GRCm39)	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	88,914,527 (GRCm39)	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88,873,633 (GRCm39)	missense	probably benign
BB008:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	88,914,624 (GRCm39)	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	88,914,624 (GRCm39)	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	88,974,529 (GRCm39)	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	88,974,529 (GRCm39)	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	88,965,896 (GRCm39)	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88,890,766 (GRCm39)	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88,889,584 (GRCm39)	missense	probably benign
R0543:Ash1l	UTSW	3	88,971,085 (GRCm39)	splice site	probably null
R0855:Ash1l	UTSW	3	88,961,761 (GRCm39)	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88,892,194 (GRCm39)	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88,892,194 (GRCm39)	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	88,942,570 (GRCm39)	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88,890,623 (GRCm39)	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88,892,204 (GRCm39)	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	88,914,659 (GRCm39)	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88,892,359 (GRCm39)	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	88,965,806 (GRCm39)	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	88,979,783 (GRCm39)	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	88,974,549 (GRCm39)	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	88,983,531 (GRCm39)	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88,873,291 (GRCm39)	missense	probably benign
R1793:Ash1l	UTSW	3	88,977,616 (GRCm39)	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88,888,862 (GRCm39)	missense	probably benign	0.00
R1909:Ash1l	UTSW	3	88,891,835 (GRCm39)	missense	probably benign	0.29
R1938:Ash1l	UTSW	3	88,891,729 (GRCm39)	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	88,973,624 (GRCm39)	missense	probably benign	0.00
R2070:Ash1l	UTSW	3	88,873,510 (GRCm39)	missense	probably damaging	1.00
R2071:Ash1l	UTSW	3	88,873,510 (GRCm39)	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88,890,571 (GRCm39)	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88,890,571 (GRCm39)	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88,892,602 (GRCm39)	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88,892,726 (GRCm39)	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88,892,726 (GRCm39)	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	88,973,605 (GRCm39)	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	88,914,674 (GRCm39)	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	88,933,733 (GRCm39)	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	88,961,785 (GRCm39)	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	88,961,785 (GRCm39)	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	88,961,693 (GRCm39)	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88,889,567 (GRCm39)	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88,889,273 (GRCm39)	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88,889,347 (GRCm39)	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88,889,347 (GRCm39)	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	88,973,722 (GRCm39)	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	88,914,506 (GRCm39)	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88,873,541 (GRCm39)	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88,892,622 (GRCm39)	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	88,979,783 (GRCm39)	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88,890,152 (GRCm39)	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88,892,641 (GRCm39)	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	88,965,941 (GRCm39)	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88,889,630 (GRCm39)	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	88,930,519 (GRCm39)	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88,892,024 (GRCm39)	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88,873,541 (GRCm39)	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	88,960,184 (GRCm39)	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	88,973,582 (GRCm39)	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88,889,701 (GRCm39)	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88,892,183 (GRCm39)	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88,888,733 (GRCm39)	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	88,930,492 (GRCm39)	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88,892,916 (GRCm39)	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	88,914,914 (GRCm39)	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	88,959,297 (GRCm39)	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	88,965,933 (GRCm39)	missense	probably damaging	1.00
R5719:Ash1l	UTSW	3	88,961,805 (GRCm39)	missense	possibly damaging	0.83
R5839:Ash1l	UTSW	3	88,890,658 (GRCm39)	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	88,976,300 (GRCm39)	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88,888,891 (GRCm39)	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88,891,343 (GRCm39)	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	88,960,450 (GRCm39)	nonsense	probably null
R6110:Ash1l	UTSW	3	88,892,436 (GRCm39)	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	88,960,080 (GRCm39)	nonsense	probably null
R6200:Ash1l	UTSW	3	88,977,834 (GRCm39)	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88,890,068 (GRCm39)	nonsense	probably null
R6331:Ash1l	UTSW	3	88,915,172 (GRCm39)	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88,891,087 (GRCm39)	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88,892,368 (GRCm39)	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	88,959,344 (GRCm39)	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	88,983,420 (GRCm39)	missense	probably benign	0.00
R6843:Ash1l	UTSW	3	88,892,695 (GRCm39)	missense	probably damaging	1.00
R6894:Ash1l	UTSW	3	88,890,298 (GRCm39)	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88,888,964 (GRCm39)	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88,889,978 (GRCm39)	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88,892,647 (GRCm39)	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88,890,764 (GRCm39)	frame shift	probably null
R7150:Ash1l	UTSW	3	88,984,381 (GRCm39)	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88,873,259 (GRCm39)	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	88,977,816 (GRCm39)	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	88,961,941 (GRCm39)	splice site	probably null
R7288:Ash1l	UTSW	3	88,873,199 (GRCm39)	start gained	probably benign
R7319:Ash1l	UTSW	3	88,888,694 (GRCm39)	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88,889,066 (GRCm39)	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88,873,304 (GRCm39)	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88,891,172 (GRCm39)	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	88,950,500 (GRCm39)	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	88,914,571 (GRCm39)	missense	probably benign
R7857:Ash1l	UTSW	3	88,891,616 (GRCm39)	nonsense	probably null
R7889:Ash1l	UTSW	3	88,873,345 (GRCm39)	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88,890,932 (GRCm39)	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	88,977,624 (GRCm39)	nonsense	probably null
R7973:Ash1l	UTSW	3	88,960,164 (GRCm39)	missense	probably benign
R8119:Ash1l	UTSW	3	88,942,734 (GRCm39)	missense	probably damaging	1.00
R8157:Ash1l	UTSW	3	88,971,014 (GRCm39)	critical splice donor site	probably null
R8162:Ash1l	UTSW	3	88,977,553 (GRCm39)	missense	probably damaging	0.99
R8194:Ash1l	UTSW	3	88,960,062 (GRCm39)	missense	probably damaging	1.00
R8306:Ash1l	UTSW	3	88,873,259 (GRCm39)	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	88,914,951 (GRCm39)	missense	probably benign	0.02
R8558:Ash1l	UTSW	3	88,891,713 (GRCm39)	missense	probably damaging	0.96
R8744:Ash1l	UTSW	3	88,965,890 (GRCm39)	missense	possibly damaging	0.89
R8923:Ash1l	UTSW	3	88,892,974 (GRCm39)	missense	possibly damaging	0.51
R8969:Ash1l	UTSW	3	88,873,598 (GRCm39)	missense	possibly damaging	0.52
R8970:Ash1l	UTSW	3	88,976,307 (GRCm39)	missense	probably benign	0.00
R9002:Ash1l	UTSW	3	88,888,715 (GRCm39)	missense	probably benign	0.17
R9023:Ash1l	UTSW	3	88,892,576 (GRCm39)	missense	probably damaging	1.00
R9032:Ash1l	UTSW	3	88,891,529 (GRCm39)	missense	probably benign	0.00
R9032:Ash1l	UTSW	3	88,889,294 (GRCm39)	missense	probably benign	0.19
R9049:Ash1l	UTSW	3	88,914,671 (GRCm39)	missense	probably benign
R9085:Ash1l	UTSW	3	88,891,529 (GRCm39)	missense	probably benign	0.00
R9085:Ash1l	UTSW	3	88,889,294 (GRCm39)	missense	probably benign	0.19
R9130:Ash1l	UTSW	3	88,965,848 (GRCm39)	nonsense	probably null
R9149:Ash1l	UTSW	3	88,914,530 (GRCm39)	missense	probably benign
R9294:Ash1l	UTSW	3	88,890,297 (GRCm39)	missense	possibly damaging	0.90
R9365:Ash1l	UTSW	3	88,889,207 (GRCm39)	missense	possibly damaging	0.63
R9450:Ash1l	UTSW	3	88,915,139 (GRCm39)	missense	possibly damaging	0.86
R9542:Ash1l	UTSW	3	88,950,566 (GRCm39)	missense	probably damaging	1.00
R9558:Ash1l	UTSW	3	88,889,521 (GRCm39)	missense	probably benign	0.02
R9572:Ash1l	UTSW	3	88,960,188 (GRCm39)	missense	probably damaging	1.00
R9688:Ash1l	UTSW	3	88,892,024 (GRCm39)	missense	probably damaging	1.00
R9736:Ash1l	UTSW	3	88,891,733 (GRCm39)	missense	probably damaging	1.00
R9765:Ash1l	UTSW	3	88,930,500 (GRCm39)	missense	probably damaging	1.00
R9789:Ash1l	UTSW	3	88,873,373 (GRCm39)	missense	probably benign
X0017:Ash1l	UTSW	3	88,891,892 (GRCm39)	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	88,977,863 (GRCm39)	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88,890,511 (GRCm39)	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88,890,016 (GRCm39)	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	88,950,524 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

Posted On

2017-06-26