Incidental Mutation 'R6035:Ppme1'
ID479149
Institutional Source Beutler Lab
Gene Symbol Ppme1
Ensembl Gene ENSMUSG00000030718
Gene Nameprotein phosphatase methylesterase 1
Synonyms1110069N17Rik, PME-1, 2700017M01Rik
MMRRC Submission 044207-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6035 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location100326737-100372307 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 100354795 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 68 (R68*)
Ref Sequence ENSEMBL: ENSMUSP00000032963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032963]
Predicted Effect probably null
Transcript: ENSMUST00000032963
AA Change: R68*
SMART Domains Protein: ENSMUSP00000032963
Gene: ENSMUSG00000030718
AA Change: R68*

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Hydrolase_4 73 199 5.2e-13 PFAM
Pfam:Abhydrolase_1 77 356 7.4e-17 PFAM
Pfam:Abhydrolase_5 78 259 1.3e-14 PFAM
Pfam:Abhydrolase_6 79 362 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208168
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 98.9%
  • 10x: 91.8%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Targeted disruption of this gene causes virtual loss of the demethylated form of phosphoprotein phosphatase 2A in the nervous system and peripheral tissues. Homozygous null mice fail to initiate normal breathing or suckling behavior and die within the first day of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m G T 6: 121,638,394 G76W probably damaging Het
Abca17 A T 17: 24,281,245 F1324Y possibly damaging Het
Abca8b A T 11: 109,971,860 probably null Het
Abcc12 A G 8: 86,517,404 M1040T probably damaging Het
Abtb1 A G 6: 88,841,806 F7L probably damaging Het
Adcy9 T C 16: 4,304,513 T558A probably benign Het
Adgrb1 A T 15: 74,540,443 T424S possibly damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankrd31 C A 13: 96,832,213 P786Q probably benign Het
Arhgap39 G T 15: 76,737,224 Y392* probably null Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Carmil2 G T 8: 105,692,563 W749L probably benign Het
Ccar1 A G 10: 62,751,785 Y867H unknown Het
Cdh13 A G 8: 118,505,698 D47G probably benign Het
Chst9 T A 18: 15,452,853 T218S probably benign Het
Clec2i G A 6: 128,893,624 V67I probably benign Het
Cox7a2 T A 9: 79,759,746 probably benign Het
Cpz A G 5: 35,517,585 C107R probably damaging Het
Dapk1 T A 13: 60,761,199 C1209S possibly damaging Het
Ddx41 T C 13: 55,533,968 M307V probably benign Het
Defa24 A G 8: 21,734,549 I5V probably benign Het
Dgcr8 A T 16: 18,258,314 N2K probably damaging Het
Ebf2 A G 14: 67,238,974 D131G probably damaging Het
Fam149b C T 14: 20,377,917 R424C probably damaging Het
Fbln2 G A 6: 91,263,353 V714M probably damaging Het
Fgf5 T C 5: 98,275,526 Y257H probably damaging Het
Fmo3 A C 1: 162,964,036 V224G probably damaging Het
Gigyf2 T C 1: 87,410,728 I394T possibly damaging Het
Glmn T A 5: 107,593,880 probably null Het
Greb1l T C 18: 10,501,025 I385T possibly damaging Het
Grhl1 C A 12: 24,608,450 Q365K probably benign Het
Gsdme G A 6: 50,229,326 T179M probably damaging Het
Gtf2a1l A G 17: 88,711,534 T349A probably benign Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Il5ra G A 6: 106,741,265 T76I probably damaging Het
Itga8 T C 2: 12,191,714 T631A probably benign Het
Kcnh6 G A 11: 106,019,152 probably null Het
Krt26 C T 11: 99,333,589 E368K probably benign Het
Lhx9 T C 1: 138,838,543 D169G possibly damaging Het
Lman1l A G 9: 57,611,747 probably null Het
Lmod3 A G 6: 97,247,273 L529P probably damaging Het
Mroh2a G A 1: 88,230,668 V146M probably damaging Het
Nup155 A G 15: 8,144,093 T891A probably benign Het
Olfr20 T C 11: 73,353,756 M1T probably null Het
Olfr341 T A 2: 36,479,984 I49F probably damaging Het
Olfr409-ps1 T C 11: 74,317,459 *145R probably null Het
Olfr739 A G 14: 50,424,527 T3A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Papln G C 12: 83,774,680 G262A probably damaging Het
Pdcd1lg2 G A 19: 29,446,035 V160I probably benign Het
Pde8b A G 13: 95,027,597 probably benign Het
Ptprn2 A T 12: 117,255,595 N949Y probably damaging Het
Qser1 C A 2: 104,787,123 D1115Y probably damaging Het
Rad54l G T 4: 116,097,469 D674E probably damaging Het
Ripk4 T A 16: 97,744,187 D420V probably damaging Het
Ros1 G T 10: 52,077,971 S1857R probably benign Het
Rsf1 A G 7: 97,662,109 E682G probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Samd4 G A 14: 47,087,872 R515H probably damaging Het
Selp T A 1: 164,141,510 W560R probably benign Het
Shc3 A T 13: 51,461,432 L163Q probably damaging Het
Shh G A 5: 28,461,399 A163V probably damaging Het
Slc17a8 T C 10: 89,592,075 R113G possibly damaging Het
Slc5a6 C A 5: 31,048,824 probably benign Het
Smarcd2 A G 11: 106,266,889 probably null Het
Sytl3 A G 17: 6,728,265 D148G probably damaging Het
Tnks G T 8: 34,918,461 H297Q possibly damaging Het
Trbv21 A T 6: 41,202,634 probably benign Het
Ube3c T C 5: 29,601,163 F268L probably benign Het
Ugt2b5 T C 5: 87,139,682 I209V probably benign Het
Usp1 A G 4: 98,929,845 N140S probably damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r129 T A 7: 21,360,609 Q228L probably damaging Het
Vmn1r209 T A 13: 22,806,032 N163Y probably benign Het
Vmn1r85 A G 7: 13,084,927 S97P probably damaging Het
Vmn2r30 C T 7: 7,334,351 M95I probably benign Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Wdr70 G A 15: 7,887,349 T529I possibly damaging Het
Zfp532 T G 18: 65,623,934 S313A possibly damaging Het
Zhx3 A T 2: 160,779,543 N901K probably benign Het
Other mutations in Ppme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Ppme1 APN 7 100333932 missense probably damaging 1.00
IGL02957:Ppme1 APN 7 100338440 missense possibly damaging 0.93
R0328:Ppme1 UTSW 7 100333975 splice site probably null
R3015:Ppme1 UTSW 7 100331877 missense probably damaging 1.00
R4042:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R4090:Ppme1 UTSW 7 100347837 missense possibly damaging 0.85
R4987:Ppme1 UTSW 7 100345071 missense probably benign 0.01
R5579:Ppme1 UTSW 7 100344975 missense probably damaging 1.00
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6374:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R6462:Ppme1 UTSW 7 100338392 missense probably benign 0.01
R7092:Ppme1 UTSW 7 100371822 start codon destroyed probably null 0.53
Predicted Primers
Posted On2017-06-26