Incidental Mutation 'R0512:Phyhipl'
ID47919
Institutional Source Beutler Lab
Gene Symbol Phyhipl
Ensembl Gene ENSMUSG00000037747
Gene Namephytanoyl-CoA hydroxylase interacting protein-like
Synonyms
MMRRC Submission 038706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0512 (G1)
Quality Score203
Status Validated
Chromosome10
Chromosomal Location70557682-70655965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70568918 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 140 (I140M)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046513] [ENSMUST00000162251] [ENSMUST00000162793]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046513
AA Change: I153M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045807
Gene: ENSMUSG00000037747
AA Change: I153M

DomainStartEndE-ValueType
FN3 49 142 6.16e-2 SMART
Blast:FN3 188 262 2e-45 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162144
AA Change: I140M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124828
Gene: ENSMUSG00000037747
AA Change: I140M

DomainStartEndE-ValueType
FN3 37 130 6.16e-2 SMART
Blast:FN3 176 212 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162251
AA Change: I108M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125179
Gene: ENSMUSG00000037747
AA Change: I108M

DomainStartEndE-ValueType
FN3 4 97 6.16e-2 SMART
Blast:FN3 143 217 9e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162470
Predicted Effect probably benign
Transcript: ENSMUST00000162793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163054
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 114,863,508 M22R probably benign Het
Abca8b C A 11: 109,950,650 M1039I probably benign Het
Actn2 A T 13: 12,277,415 I653N probably damaging Het
Actr8 G T 14: 29,978,556 V31L probably benign Het
Adam30 T C 3: 98,162,125 C425R probably damaging Het
Armc1 A G 3: 19,149,495 V89A possibly damaging Het
Atr T C 9: 95,935,526 M2090T probably damaging Het
Braf T A 6: 39,664,989 probably benign Het
Cant1 A T 11: 118,411,265 N75K probably benign Het
Chd7 C T 4: 8,805,139 probably benign Het
Clec16a A G 16: 10,614,580 Y488C probably damaging Het
Col6a3 A T 1: 90,821,798 probably benign Het
Col9a2 T A 4: 121,054,307 M615K probably benign Het
D3Ertd254e T C 3: 36,166,113 C762R probably damaging Het
Dedd G A 1: 171,340,930 R228H probably damaging Het
Dhtkd1 C T 2: 5,904,091 D731N probably damaging Het
Ercc2 A G 7: 19,393,887 T651A probably damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fam193a T C 5: 34,426,391 S19P probably damaging Het
Fam208a T C 14: 27,446,406 F302L probably damaging Het
Fam43a T C 16: 30,601,735 V379A possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fat1 C A 8: 44,951,332 Y373* probably null Het
Fbxl15 A C 19: 46,329,422 D181A probably damaging Het
Flt3 A T 5: 147,341,270 C831* probably null Het
Foxj3 T A 4: 119,585,836 probably benign Het
Glul T C 1: 153,905,386 probably benign Het
Gm16380 A T 9: 53,884,245 noncoding transcript Het
Gm7964 A T 7: 83,755,950 noncoding transcript Het
Hipk1 A G 3: 103,760,574 F559S possibly damaging Het
Hnf4g A T 3: 3,651,622 I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icosl A G 10: 78,071,966 N120S possibly damaging Het
Ift172 A G 5: 31,285,477 V155A possibly damaging Het
Kdm4c A G 4: 74,333,794 E426G probably benign Het
Kif23 A G 9: 61,918,975 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,779,134 C1456Y possibly damaging Het
Lamc3 T A 2: 31,937,968 L1378Q probably damaging Het
Larp1b T A 3: 40,970,034 L121M probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lepr A C 4: 101,814,704 D975A possibly damaging Het
Magi1 A G 6: 93,694,064 V1068A probably damaging Het
Malt1 T A 18: 65,458,200 N358K probably damaging Het
Mfap4 T A 11: 61,487,945 W240R probably damaging Het
Mis18a A G 16: 90,726,356 V84A possibly damaging Het
Mns1 A G 9: 72,449,471 E308G possibly damaging Het
Mpp2 C A 11: 102,062,290 L258F possibly damaging Het
Myh2 A G 11: 67,188,678 E987G probably damaging Het
Myof A G 19: 37,954,524 V702A possibly damaging Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Nrxn2 A G 19: 6,517,198 T1360A probably damaging Het
Obox6 A G 7: 15,833,949 I191T probably benign Het
Pacs2 G T 12: 113,050,927 R236L probably damaging Het
Pcdhb2 T G 18: 37,295,979 V335G probably damaging Het
Pkhd1 T C 1: 20,310,514 probably benign Het
Ppp1r3b T G 8: 35,384,417 C137G probably damaging Het
Prdm13 T A 4: 21,678,490 I667F probably damaging Het
Prex2 A G 1: 11,199,933 M1281V probably benign Het
Rab40b A G 11: 121,359,586 F81L probably damaging Het
Rb1cc1 T C 1: 6,248,543 S729P probably damaging Het
Rcl1 A G 19: 29,128,097 D228G probably damaging Het
Rhbdf1 A T 11: 32,210,875 C19* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf150 G A 8: 82,864,178 V57M probably benign Het
Rp9 A G 9: 22,458,719 F51L probably benign Het
Sav1 A T 12: 69,969,201 Y274* probably null Het
Scn4a A T 11: 106,345,677 D252E probably damaging Het
Scn5a T C 9: 119,550,658 T187A probably damaging Het
Sigirr T A 7: 141,092,420 D229V probably benign Het
Slc39a13 T C 2: 91,065,686 S157G possibly damaging Het
Slc6a20a A G 9: 123,660,406 S191P probably damaging Het
Sorl1 C A 9: 42,067,832 A457S probably benign Het
Spag5 A G 11: 78,319,586 probably benign Het
Spon1 A G 7: 113,836,833 E119G possibly damaging Het
Spred2 T A 11: 20,008,485 probably benign Het
Sprr3 T G 3: 92,457,477 Q20P possibly damaging Het
Strn3 A T 12: 51,627,183 F464L possibly damaging Het
Sun1 A G 5: 139,234,847 probably benign Het
Sypl2 A G 3: 108,226,170 W28R possibly damaging Het
Syt5 A T 7: 4,542,814 V150D probably damaging Het
Thsd7a A G 6: 12,379,605 I940T possibly damaging Het
Tnrc6a T A 7: 123,186,728 probably benign Het
Trp53 T A 11: 69,588,683 L203Q probably damaging Het
Tubgcp4 T C 2: 121,175,419 V96A probably benign Het
Usp17la A G 7: 104,861,039 T284A possibly damaging Het
Usp34 T C 11: 23,451,997 M2409T probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r56 A G 7: 12,715,423 I296T probably benign Het
Vmn2r67 A G 7: 85,150,692 V446A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Other mutations in Phyhipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Phyhipl APN 10 70570830 missense probably damaging 1.00
IGL03374:Phyhipl APN 10 70565279 missense possibly damaging 0.47
PIT4366001:Phyhipl UTSW 10 70568958 missense probably benign
R0688:Phyhipl UTSW 10 70559255 missense probably damaging 1.00
R1136:Phyhipl UTSW 10 70569072 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1465:Phyhipl UTSW 10 70570968 missense probably damaging 1.00
R1802:Phyhipl UTSW 10 70599025 missense probably benign
R1978:Phyhipl UTSW 10 70559761 missense possibly damaging 0.94
R4077:Phyhipl UTSW 10 70569073 missense probably damaging 1.00
R4960:Phyhipl UTSW 10 70568985 missense probably benign 0.40
R4976:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5119:Phyhipl UTSW 10 70569074 missense probably damaging 1.00
R5739:Phyhipl UTSW 10 70559569 missense possibly damaging 0.92
R6303:Phyhipl UTSW 10 70559557 unclassified probably null
R6304:Phyhipl UTSW 10 70559557 unclassified probably null
R6649:Phyhipl UTSW 10 70569013 missense probably damaging 1.00
X0022:Phyhipl UTSW 10 70568961 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGGACCTCAGTTCATTCCGACC -3'
(R):5'- CTTAAACAGGAGCCCTGCTCTTAGC -3'

Sequencing Primer
(F):5'- ACCTCAGTTCATTCCGACCAATATG -3'
(R):5'- CATAGTTGATGAAAGTCCTTCCG -3'
Posted On2013-06-12